Skeletal muscle

Báo cáo y học: "Skeletal muscle sodium glucose co-transporters in older adults with type 2 diabetes undergoing resistance training"

Báo cáo y học:
... study shows that individuals with uncontrolled type diabetes (characterized by poor glycemic control and sustained hyperglycemia), undergoing moderate to high intensity resistance exercise training ... C, Layne JE, Munoz-Orians L, et al A randomized controlled trial of resistance exercise training to improve glycemic control in older adults with type diabetes Diabetes Care 20 02; 25( 12) :23 35-41 ... Care in Diabetes Diabetes Care 20 05 ;28 (suppl_1):S4-S36 24 Sigal RJ, Kenny GP, Wasserman DH, Castaneda-Sceppa C Physical activity/exercise and type diabetes Diabetes Care 20 04 ;27 (10) :25 18-39 25 ...
  • 8
  • 194
  • 0

Tài liệu Báo cáo khoa học: Subproteomics analysis of Ca2+-binding proteins demonstrates decreased calsequestrin expression in dystrophic mouse skeletal muscle pdf

Tài liệu Báo cáo khoa học: Subproteomics analysis of Ca2+-binding proteins demonstrates decreased calsequestrin expression in dystrophic mouse skeletal muscle pdf
... comparative immunoblotting data, it was of interest to re-examine the fate of calsequestrin by studying the entire complement of key Ca2+-binding elements in dystrophindeficient skeletal muscle fibres Because ... ÔStains-AllÕ was used to determine potential changes in the expression of major Ca2+-binding proteins in dystrophic fibres A comparison between the selective dye labelling of protein spots in Fig ... on the expression of Ca2+-binding proteins The relatively unique combination of the pI value and molecular mass of individual 2D spots can be useful in the initial identification of proteins However,...
  • 10
  • 152
  • 0

Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx
... Decreasing the Gd3+ concentration on the trans side of the channel by addition of equimolar EGTA resulted in the recovery of the channel from the inhibition (Fig 3D) in less than one minute The observation ... The effect of lm gadolinium on the [3H ]ryanodine binding to the HSR was investigated at different ryanodine concentrations Gadolinium (5 lm) 467 Effect of gadolinium on RyR1 Fig Effect of gadolinium ... activation of the channel at 100–250 lm and inactivation at higher luminal calcium concentrations [15,16] As the effect of the luminal calcium concentration was voltage-dependent and the activation...
  • 8
  • 200
  • 0

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: ... 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F...
  • 16
  • 136
  • 0

Báo cáo khoa học: Progressive decrease of phosphocreatine, creatine and creatine kinase in skeletal muscle upon transformation to sarcoma pot

Báo cáo khoa học: Progressive decrease of phosphocreatine, creatine and creatine kinase in skeletal muscle upon transformation to sarcoma pot
... Levels of creatine and creatine kinase in sarcoma of creatine and an increased choline ⁄ creatine ratio, and a decrease in the activity of CK and some of its isoforms in several different forms of ... are unable to retain their intracellular creatine pool in the form of phosphocreatine The simultaneous decrease in phosphocreatine, creatine and CK in sarcoma tissue suggests that creatine availability ... Expression of mRNA of MCK and sMitCK isoforms of creatine kinase and b-actin in normal muscle (NM) and 3MC induced sarcoma tissue (ST) of mouse Relative expression of mRNA BCK protein expression in both...
  • 12
  • 130
  • 0

Báo cáo khoa học: Mapping contacts between regulatory domains of skeletal muscle TnC and TnI by analyses of single-chain chimeras potx

Báo cáo khoa học: Mapping contacts between regulatory domains of skeletal muscle TnC and TnI by analyses of single-chain chimeras potx
... interactions between skeletal muscle TnC( 1–91) and TnI( 98–182), we have constructed two single chain chimeras composed of these domains The chimeras were formed by residues 1–91 of TnC and residues ... the TnC( 1–91) and TnI( 98–182) form a regulatory subunit, and that the first half of the C terminus of TnI is important for this binding Structural information of the interaction of TnC and TnI ... Contacts between skeletal TnC and TnI regulatory domains TnC is dumbbell-shaped protein with two globular domains, each composed of two EF-hand calcium binding motifs, which are connected by...
  • 12
  • 91
  • 0

Báo cáo Y học: Fluorescence study of the high pressure-induced denaturation of skeletal muscle actin pdf

Báo cáo Y học: Fluorescence study of the high pressure-induced denaturation of skeletal muscle actin pdf
... Pressure-induced denaturation of actin (Eur J Biochem 269) 365 The aim of the present study was to complete a study of F ® G transition and denaturation of actin under pressure Use of a ... that the decrease in the intensity of ¯uorescence in the presence of ATP was not attributable to the denaturation of G -actin Rather these data would represent the rapid exchange between the bound ... to the dissociation of actin and myosin under pressure Then in situ observations were made by monitoring the ¯uorescence of an eADP bound actin HMM (the products of myosin digested by trypsin)...
  • 8
  • 156
  • 0

Body composition in the elderly: Reference values and bioelectrical impedance spectroscopy to predict total body skeletal muscle mass pot

Body composition in the elderly: Reference values and bioelectrical impedance spectroscopy to predict total body skeletal muscle mass pot
... disease and aging Furthermore, we wanted to investigate the validity of existing BIA-equations to predict SMM in our population, and if needed, to develop a regression equation for the prediction ... TBSMM-equations; one using the same independent predictors as Kyle and Janssen4,8 and two using BIS measurements, i.e the first one corresponding to SF-BIA The trunk has limited impact on whole body impedance ... writing of the manuscript, Ingvar Bosaeus initiated and designed the present study and contributed to analysing data and writing the manuscript References Dey DK, Bosaeus I, Lissner L, Steen B Body...
  • 7
  • 143
  • 0

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC ... CARP is a substrate of calpain Considering the sarcomeric localization of both CARP and calpain and the fact that calpain cleaves another member of the MARPs family, the possibility that CARP could...
  • 16
  • 123
  • 0

Báo cáo hóa học: " Overexpression of microRNA-206 in the skeletal muscle from myotonic dystrophy type 1 patients" docx

Báo cáo hóa học:
... is increased in DM1 muscle In this work we have profiled the expression of miR -13 3 (miR -13 3a, miR -13 3b), miR -1, miR -18 1 (miR -18 1a, miR181b, miR -18 1c) and miR-206, specifically induced during ... size In order to gain better insights about the role of miRNAs in DM1, Page of we have also analyzed the muscular expression of the miR -10 3 and miR -10 7 CTG-repeat binding miRNAs A combination of ... observed induction during myogenesis [12 -14 ] Moreover, miR -1 promotes differentiation of cardiac and skeletal progenitors and their exit from the cell cycle in mammals [15 ], while miR -13 3 inhibits their...
  • 9
  • 148
  • 0

Báo cáo hóa học: "Assessment of skeletal muscle fatigue of road maintenance workers based on heart rate monitoring and myotonometry" docx

Báo cáo hóa học:
... According to the heart rate monitoring data the road construction and maintenance workers road repair workers and pavers – can be subdivided into hard and moderately hard work categories and despite ... insignificant stiffness of calf-muscles For example, very often two workers perform the construction of road edge (roadside) together; the construction of road edge requires lifting of a concrete edge which ... postures and constantly repeated arm movements We conclude that road construction and maintenance workers can be subdivided into three categories basing on the dynamics of muscle tone during one work...
  • 9
  • 127
  • 0

báo cáo hóa học:" Isokinetic eccentric exercise can induce skeletal muscle injury within the physiologic excursion of muscle-tendon unit: a rabbit model" doc

báo cáo hóa học:
... subcutaneously, an incision was made from the midcalf to the plantar surface of the foot on the lateral aspect of each hind limb The Achilles tendon was isolated with special care to maintain the ... K-wire transfixation through the proximal tibia The distal tendinous insertion was freed by means of osteotomy at the calcaneal tuberosity and then clamped to the load cell of the Page of (page number ... irrigating them with warm normal saline Additional anesthesia was given when needed The rabbits were sacrificed at the completion of the study For each triceps surae muscle, the load and deformation...
  • 7
  • 123
  • 0

báo cáo hóa học:" Initial intramuscular perfusion pressure predicts early skeletal muscle function following isolated tibial fractures" pptx

báo cáo hóa học:
... deviation) rior and posterior tibial compartment, and the skeletal muscle function in the early rehabilitation phase, i.e weeks postoperatively The decrease in perfusion pressure after 24 hours, which ... gastrocnemius muscle contu- Figure Regression analysis of perfusion pressure on the muscle deficit after 24 hours, in dorsiflexion at weeks after trauma Regression analysis of perfusion pressure on the muscle ... between the perfusion pressure after 24 hours and the functional outcome in muscle performance after weeks There was no correlation between muscle function and the intracompartimental pressure itself...
  • 8
  • 110
  • 0

báo cáo hóa học: " Influence of dietary state and insulin on myocardial, skeletal muscle and brain [18F]fluorodeoxyglucose kinetics in mice" pptx

báo cáo hóa học:
... determine, if myocardial [18F]-fluorodeoxyglucose (FDG) kinetics in mice in a non-fasting condition or a fasting condition differ after injection of insulin and furthermore assess the effect on ... already demonstrated the feasibility of determining the radiotracer arterial input function and the tissue kinetics in myocardium, skeletal muscle, and brain in intact mice [7-10] The purpose of the ... of fasting Finally, in the fourth group, defined as “fasted, insulin (n = 5), the effect of acute insulin administration immediately prior to the i.v FDG on the FDG tissue kinetics was examined...
  • 9
  • 113
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập