Cardiac muscle tissue

MÔ CƠ (Muscle Tissue)

MÔ CƠ (Muscle Tissue)
... bào 2 CƠ VÂN / THỊT (Skeletal tissue) vân loại bắp tay, bắp chân, đùi, mông, v.v… Mỗi bắp gồm nhiều sợi hợp thành Mỗi sợi thể hợp bào, có chiều dài từ - 45 cm, đường kính 100 micron CƠ VÂN ... ngang đĩa A - Sơi actin - Sơ myozin 3 CƠ TIM (cardiac tissue) tim tổ chức đặc biệt, mang đặc tính vân trơn tim thành phần tạo nên thành tim động vật tim giống vân chổ bao gồm nhiều nhân ... vùng cài lược CẤU TẠO SIÊU VI SỢI CƠ VÂN - Túi tận cùng; - Túi H; - Ống nội; - Ty thể; - T vi quản T ống ngang; - Màng sợi cơ; - Màng đáy; - Sợi võng; - Tơ TƠ CƠ VÂN a - Cấu tạo vi thể tơ vân;...
  • 10
  • 123
  • 0

báo cáo hóa học: " A swimming robot actuated by living muscle tissue" docx

báo cáo hóa học:
... muscle installation into the robotic swimmer was approximately hour Table I: Muscle actuator parameters and swimming robot performance parameters (mean values, N = 4) at the maximum forward swimming ... of muscle actuator performance, swimming efficiency and locomotory maneuverability Each robotic platform was designated "B1x", where "x" indicated the build-up, serialized as "a, b, c, " for each ... anticipate that a multi-day robotic maintenance or lifespan can be achieved by surrounding the muscle actuators with a specific bath of amphibian ringer's solution comprising antibiotic and antimycotic...
  • 9
  • 131
  • 0

Đại cương về Mô và Phôi : MÔ CƠ (Muscle Tissue) part 2 potx

Đại cương về Mô và Phôi : MÔ CƠ (Muscle Tissue) part 2 potx
... 3 CƠ TIM (cardiac tissue) tim tổ chức đặc biệt, mang đặc tính vân trơn tim thành phần tạo nên thành tim động vật tim giống vân chổ bao gồm nhiều nhân giống trơn chổ nhân nằm tế bào Về ... CẤU TẠO SIÊU VI SỢI CƠ VÂN - Túi tận cùng; - Túi H; - Ống nội; - Ty thể; - T vi quản T ống ngang; - Màng sợi cơ; - Màng đáy; - Sợi võng; - Tơ TƠ CƠ VÂN a - Cấu tạo vi thể tơ vân; ... bào riêng lẻ, có vách ngăn Giữa sợi có cầu nối liên tiếp với Mặt cắt dọc Nhân CƠ TIM (tt) Trong thành phần tim, sợi cơ, tim có cấu trúc đặc biệt, sợi Purking Sợi tim giúp tim co bóp sợi Purking...
  • 5
  • 135
  • 0

Đại cương về Mô và Phôi : MÔ CƠ (Muscle Tissue) part 1 pps

Đại cương về Mô và Phôi : MÔ CƠ (Muscle Tissue) part 1 pps
... tạo sợi vân: Màng c : Màng mỏng, gồm hai lớp: lớp nằm phỉa tương đương với màng tế bào, lớp màng liên kết gồm sợi sinh keo xếp thành dây Hai màng cách khoảng từ 14 0 - 240 A0 tương: Cũng giống ... bào 2 CƠ VÂN / THỊT (Skeletal tissue) vân loại bắp tay, bắp chân, đùi, mông, v.v… Mỗi bắp gồm nhiều sợi hợp thành Mỗi sợi thể hợp bào, có chiều dài từ - 45 cm, đường kính 10 0 micron CƠ VÂN ... 1 CƠ TRƠN (Smooth tissue) trơn hay gọi nội tạo nên phần lớn quan nội tạng động vật Đơn vị cấu tạo trơn tế...
  • 5
  • 126
  • 0

Báo cáo y học: " Propagated repolarization of simulated action potentials in cardiac muscle and smooth muscle" pptx

Báo cáo y học:
... resting potential (RP) and predominate during the rising phase and plateau phase of the AP The myocardial cell was assumed to be a cylinder 150 µm long and 16 µm in diameter, and the smooth muscle ... resistance of K+ compared to Na+ (cardiac muscle) or Ca++ (smooth muscle) were set to give resting potentials (RPs) of -80 mV for cardiac muscle and -55 mV for smooth muscle During excitation, the action ... Cardiac Cardiac Muscle and Smooth Muscle Circuit diagram used for study of propagated repolarization in cardiac muscle and smooth muscle A: 5-cell chain A depolarizing stimulating pulse (IS1; 0.50...
  • 9
  • 102
  • 0

Báo cáo y học: "Repolarization of the action potential enabled by Na+ channel deactivation in PSpice simulation of cardiac muscle propagation" ppt

Báo cáo y học:
... because of instability in the PSpice pro- gram, the problem was solved by inserting the BB-2 into the Na+ leg to produce deactivation of the Na+ conductance turned on by the first BB (BB-1) BB-2 ... are in the same leg of the Hodgkin-Huxley circuit, namely the Na+ conductance leg The first BB produced activation of the Na+ conductance, and the second produced deactivation of the Na+ channel ... isolate the input terminal of BB2 from BB-1 Thus, any hindrance of BB1's function by BB2 was avoided The cells in the chain were either connected by low-resistance pathways (gap-junction channels)...
  • 7
  • 73
  • 0

Báo cáo y học: " Effect of transverse gap-junction channels on transverse propagation in an enlarged PSpice model of cardiac muscle" pps

Báo cáo y học:
... plots in panel A show that when there were no or few (0 or 10) longitudinal gj -channels, adding many transverse gj -channels had no effect on TPT In contrast, when there were many longitudinal channels ... 2: Summary of Total Propagation Time (TPT) and Velocity (θ) for Various combinations of longitudinal and transverse gapjunction channels in the 10 × 10 model for cardiac muscle No of channels TPT ... longitudinal gjchannels were inserted, if many transverse gj -channels were also present Figure shows graphs of TPT as a function of the number of transverse (A) and longitudinal (B) gj -channels Panel...
  • 11
  • 61
  • 0

Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf

Báo cáo y học:
... cross-sectional profile of longitudinal propagation velocities of simulated APs through a small-diameter bundle of cardiac muscle fibers indicates that velocity is lower in the depths of the bundle than at ... chains of the cardiac bundle Figure Action potential (AP) traces recorded intracellularly in cells 1, 5, and 10 of each of the 20 parallel chains of the cardiac bundle The order of firing for panel ... parallel chains, the propagation velocity in the core chain was the same as that in the surface chain, as found in the present study In summary, the present study demonstrates that longitudinal...
  • 9
  • 63
  • 0

Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx

Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx
... preponderant role of p38 in the regulation of gene expression at the level of mRNA stability The p38 MAP kinase is now known to stabilize a wide range of mRNAs including those encoding TNF-a, interferon ... organization of the actin cytoskeleton and the superinduction of the CTGF/ CCN2 gene Rho-like GTPases play a pivotal role in orchestrating changes in the actin cytoskeleton in response to various ... activation of the CTGF/CCN2 gene although RhoA GTPase- independent required an intact cytoskeleton, and, at least in part, the upstream activation of PtdIns 3 -kinase Inhibition of PtdIns 3 -kinase reduced...
  • 15
  • 167
  • 0

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: ... 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F...
  • 16
  • 135
  • 0

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC ... CARP is a substrate of calpain Considering the sarcomeric localization of both CARP and calpain and the fact that calpain cleaves another member of the MARPs family, the possibility that CARP could...
  • 16
  • 122
  • 0

Báo cáo y học: "Human cardiac tissue in a microperfusion chamber simulating extracorporeal circulation ischemia and apoptosis studies" docx

Báo cáo y học:
... impact on the calcium homoeostasis in the cardiomyocytes the initial and final calcium ratio values had to be analyzed This was defined as Δ-ratio; Δ-ratio = ratiofinal-ratioinitial Significant ... routine preoperative examinations, patient evaluation and participated in the study design and coordination EU performed the statistical analysis MR and MM participated in the experiments and data ... before cardiopulmonary bypass and was processed immediately Each biopsy was transmuraly divided with a scalpel in about to 10 cubic pieces measuring approximately 500 μm Cardiac specimens were randomly...
  • 8
  • 96
  • 0

Báo cáo khoa học: "Erythropoietin improves skeletal muscle microcirculation and tissue bioenergetics in a mouse sepsis model" ppsx

Báo cáo khoa học:
... received general anaesthesia with ketamine/xylazine 80:10 mg/kg via intraperitoneal injection Sepsis was induced by cecal ligation and perforation (CLP) An incision was made along the linea alba The ... tissues in the cardiovascular system, including cardiomyocytes, vascular smooth muscle, and endothelial cells, and has been shown to mediate anti-apoptotic, anti-inflammatory, and endothelial cell ... important intellectual content and approved the final version of the manuscript PY, WH, and JR carried out the animal experiments and acquisition of data RK and AX contributed equally in drafting...
  • 7
  • 73
  • 0

Báo cáo y học: "Prediction of hospital outcome in septic shock: a prospective comparison of tissue Doppler and cardiac biomarkers" pdf

Báo cáo y học:
... (angina or myocardial infarction) or cardiac surgery Echocardiography Materials and methods This prospective observational study was approved by the Princess Alexandra Hospital Human Research Ethics ... Department of Echocardiography, Princess Alexandra Hospital, Ipswich Road, Brisbane, 4102, Australia 4Department of Intensive Care, Princess Alexandra Hospital, Ipswich Road, Brisbane, 4102, Australia ... function and cardiac biomarkers incorporated into this study Despite demonstrating value in a range of cardiovascular diseases [42], and more recently in a study of general ICU patients by Ikonomidis...
  • 11
  • 84
  • 0

EFFECT OF CORONARY PERIVASCULAR ADIPOSE TISSUE ON VASCULAR SMOOTH MUSCLE FUNCTION IN METABOLIC SYNDROME

EFFECT OF CORONARY PERIVASCULAR ADIPOSE TISSUE ON VASCULAR SMOOTH MUSCLE FUNCTION IN METABOLIC SYNDROME
... Metabolic Syndrome and Coronary Artery Disease Coronary Microvascular Dysfunction in Metabolic Syndrome Coronary Macrovascular Dysfunction in Metabolic Syndrome Adipose Tissue, Distribution ... Owen EFFECT OF CORONARY PERIVASCULAR ADIPOSE TISSUE ON VASCULAR SMOOTH MUSCLE FUNCTION IN METABOLIC SYNDROME Obesity increases cardiovascular disease risk and is associated with factors of the metabolic ... microvascular dysfunction in MetS is currently under investigation Coronary Macrovascular Dysfunction in Metabolic Syndrome In contrast to the microcirculation, the larger conduit vessels contribute...
  • 111
  • 55
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập