Extraction and characterization of chitin and chitosan from marine sources in Arabian Gulf
EXTRACTION AND CHARACTERIZATION OF CHITIN FROM CRUSTACEANS
... typical of fi -chitin) The spectrum of chitin from Fusarium oxysporum was different from the rest Thus, the relative intensity of the bands between 2968 and 2850 cm-’ was different from those of the ... Meyers and K S Lee, Isolation and characterization of chitin from crawfish shell waste J Agric Food Chem 37, 575 (1989) P V Kamasatri and P V Prabhu, Preparation of chitin and glucosamine from ... reported by other authors’ and to that of chitin from Fusarium oxysporum and other fungi.” 3.2 Characterization of the chitin samples The physico-chemical properties of the chitin samples were studied...
- 9
- 409
- 1
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... [10], and Porphyromonas gingivalis [11], parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14] MGL has been implicated in the ... individual isotypes as well as the significance of their redundancy remain to be elucidated Entamoeba histolytica, a causative agent of amoebiasis, affects an estimated 50 million people and results ... and hamster models [26] (Kobayashi and Nozaki, unpublished results) The limited presence of MGL among organisms, and the remarkable differences in the toxicity of TFM against amoeba and mammalian...
- 13
- 406
- 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge of the enzymatic activity involved in the oxidative ... Furthermore, we report the cloning, the expression and the characterization of the recombinant protein rBcp2 in order to shed light on its role in the detoxification process and on its catalytic mechanism...
- 11
- 565
- 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx
... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efficient in the stimulation of cAMP production, CRFR1c and CRFR1b have ... independent of cAMP and IP3 [11,12,33] Neither CRFR1f, g or h isoforms were able to stimulate any of the cis-elements Instead the reporter gene expression decreased when these isoforms were cotransfected...
- 10
- 671
- 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... indicating that Rv1399c is composed of 22% of a- helices, 25% of b-strand and 39% of random coil The catalytic triad is located at the bottom of a small ˚ ˚ pocket, 20 A length and 10 A wide The pocket ... hydrolases (Fig 3) These enzymes share a functional catalytic triad made of a catalytic nucleophile serine, associated to a proton carrier histidine and a charge relaying aspartic (or glutamic) acid...
- 9
- 584
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax ... proteins A- 6-D45918: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl -D-amino acid amidohydrolase; A- 6-D45919: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl-D-Asparate amidohydrolase; A- 6-D50061:...
- 11
- 656
- 0
Báo cáo khoa học: Characterization of c-tocopherol methyltransferases from Capsicum annuum L and Arabidopsis thaliana pptx
... analysis of methyltransferases have revealed sequential as well as ping-pong mechanisms [31–33] Two closely related methyltransferases involved in the biosynthesis of isoquinoline alkaloids displayed ... with the molecular mass of c-TMT from A thaliana (Fig 4B) The presence of only one labelled band is also indicative that the highly aggregated form of c-TMT observed during initial steps of purification ... composition of plants to enhance human nutrition and health Annu Rev Plant Physiol Plant Mol Biol 50, 133–161 Soll, J., Douce, R & Schultz, G (1980) Site of biosynthesis of a-tocopherol in spinach chloroplasts...
- 9
- 581
- 0
Báo cáo khoa học: Comparative biochemical characterization of nitrile-forming proteins from plants and insects that alter myrosinase-catalysed hydrolysis of glucosinolatesk docx
... M Burow et al Nitrile-forming proteins from plants and insects Table Biochemical characteristics of ESP The effects of variable temperature, phosphate ions, radical scavengers, and reducing agents ... thaliana ESP and P rapae NSP alter the outcome of myrosinase-catalysed glucosinolate hydrolysis, this comparative biochemical characterization revealed a number of differences between these two proteins, ... Burow et al Nitrile-forming proteins from plants and insects S Glc S O S SO3- O SO3- S Glc O N ial ESPs were originally described as 35–40 kDa proteins that promote the formation of epithionitriles,...
- 15
- 394
- 0
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt
... was 0.7 and overall G-factor, a measure of the normality of the structure, was 0.0 Fig SDS/PAGE and activity analysis of recombinant cellobiohydrolase (A) SDS/ PAGE [10% (w/v) gel] analysis of ... (1985) Isolation and characterization of the endoglucanases of Talaromyces emersonii Biochem J 225, 365–374 29 McHale, A & Coughlan, M (1988) Purification of beta glucosidases from Talaromyces emersonii ... classification of cellulases Eur J Biochem 258, 200–206 68 Takashima, S., Iikura, H., Nakamura, A. , Hidaka, M., Masaki, H & Uozumi, T (1998) Isolation of the gene and characterization of the enzymatic...
- 12
- 553
- 0
Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx
... for the Ndh membrane subcomplex The Ndh antibodies recognized the 46, 28, 18 and 12 kDa polypeptides, corresponding to the NdhH, -K, -J and -E subunits of the Ndh complex The intact Ndh complex, ... et al of the ndh genes is much higher in BS chloroplasts, and elevated amounts of the Ndh complex have been found in these plastids [18] The function of the Ndh complex is still a matter of debate ... kDa), NdhE (12 kDa), NdhF (83 kDa), NdhG (18 kDa), NdhH (45 kDa), NdhI (21 kDa), NdhJ (18 kDa), NdhK (29 kDa) The 75, 51 and 23 kDa subunits are assigned as the soluble subcomplex of the Ndh complex...
- 12
- 431
- 0
Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt
... mut STAT5 AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGACTTCCCAA GAACA CCGCTGTTGCTCAATCGACTAGCCAA GAACA GCCGTGTAGTTTCTTGGAAATTTCTGG GCCGTGTAGTTTAGATTAAATTTCTGG mut STAT6 Int16 ... CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG STAT3 mut STAT3 GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC STAT4 mut STAT4 GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC STAT5 mut STAT5 ... G AAA TAC CGA CTG CTG CAG TCA TG CTG GTT ACC AG AAC ACA AGG AA TTC AGG AAC ATG TTT CAA GTG AAG TTT GCA GAG CCG CAG TTT AAC AGG TGG AAC GAC GG AAC AAA GCA G CCG CCC CTT T GTC GTG CCA GA TAC CCG...
- 14
- 456
- 0
Báo cáo hóa học: " Detection and characterization of chicken anemia virus from commercial broiler breeder chickens" pdf
... we report detection of CAV and characterization of isolates based on sequence and phylogenetic analysis of partial VP1 gene from commercial broiler breeder chickens in Malaysia Level of transmission ... ESM from eggs collected from commercial broiler breeder farms Figure Detection of CAV DNA in pooled embryonic tissues and ESM from eggs collected from commercial broiler breeder farms As it is ... profile of I-75, L-97, K-139 and E-144 suggesting of a possible evidence of recombination event Figure chickens breeder ELISA results of serum collected from commercial broiler ELISA results of...
- 11
- 389
- 0
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx
... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine protease subfamily S8A Expression of ... stearothermophilus protease promoter Protease promoter represents the predicted alkaline serine protease promoter region E coli protease promoter represents, E.coli lon protease promoter Effect of pH and temperature...
- 10
- 426
- 0
Báo cáo hóa học: " Preparation and Characterization of Nano structured Materials from Fly Ash: A Waste from Thermal Power Stations, by High Energy Ball Milling" potx
... photomicrographs of fresh and modified fly ash (A and B) SEM of fresh fly ash at 1,000 and 2,500 times magnification, (C and D) SEM of ball milled fly ash for 20 h at 1,000 and 3,000 times magnification, (E and ... 10:1 ratio of balls to fly ash and milling chamber and balls were of tungsten carbide, the ball diameter was 10 mm Toluene was used as the medium with an anionic surface active agent to avoid agglomerations; ... utilization of fly ash and with understanding of potential environmental and health impacts associated with its disposal by land filling In this paper an attempt has been made to modify the fly ash by...
- 8
- 469
- 0
Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf
... M and Collins, M D Molecular taxonomic Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis 223 studies on Streptococcus uberis types I and ... profile using the restriction enzymes RsaI and AvaII RFLP analysis of the 16S rRNA gene had Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis ... Abdulmawjood, A and Lämmler, C 2000 Determination of intraspecies variations of the V2 region of the 16S rDNA Identification and epidemiological characterization of Streptococcus uberis isolated from bovine...
- 11
- 508
- 0
Từ khóa: isolation and characterization of vascular endothelial cells from murine heart and lung1 b plates — 3 4 in 19 mm and over thickness and alternate from 3 8 in 10 mm but less than 3 4 in 19 mm thickness procedure qualification2 b plates — 3 4 in 19 mm and over thickness and alternate from 3 8 in 10 mm but less than 3 4 in 19 mm thickness performance qualificationyou can make other adjustments to the motion path animation by hovering on the animation in the animation list clicking on the down arrow and choosing from the options in effect options or timing4 wadsworth s model of accumulated health risks from family sourcesto monitor pahs from automobile sources in puerto ricoextraction of chitin and chitosanisolation characterization and material properties of 4 o methylglucuronoxylan from aspeneffects of chitin chitosan and their derivatives on human hemostasisantidiabetic activity and cholesterol lowering effect of chitin chitosan and their derivativesbiomedical applications of chitin and chitosan derivativesmedical applications of chitin and chitosan going forwardindustrial applications of chitin and chitosan derivativesseparation membranes from chitin and chitosan derivativesextraction and characterization of dissolved organic matterBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ