NGHIÊN CỨU XÂY DỰNG LỘ TRÌNH PHÁT TRIỂN CHÍNH PHỦ ĐIỆN TỬ Ở VIỆT NAM VÀ ĐỀ XUẤT MÔ HÌNH CHÍNH PHỦ ĐIỆN TỬ TẠI ĐẠI HỌC THÁI NGUYÊN

Nghiên cứu xây dựng lộ trình phát triển chính phủ điện tử việt nam đề xuất hình chính phủ điện tử tại đại học thái nguyên

 Nghiên cứu xây dựng lộ trình phát triển chính phủ điện tử ở việt nam và đề xuất mô hình chính phủ điện tử tại đại học thái nguyên
... ĐẠI HỌC THÁI NGUYÊN KHOA CÔNG NGHỆ THÔNG TIN Đoàn Mạnh Hồng NGHIÊN CỨU XÂY DỰNG LỘ TRÌNH PHÁT TRIỂN CHÍNH PHỦ ĐIỆN TỬ VIỆT NAM VÀ ĐỀ XUẤT MÔ HÌNH CHÍNH PHỦ ĐIỆN TỬ TẠI ĐẠI HỌC THÁI NGUYÊN ... Trung tâm Học liệu – Đại học Thái Nguyên http://www.lrc-tnu.edu.vn 21 Chƣơng ĐỀ XUẤT LỘ TRÌNH XÂY DỰNG VÀ THỰC HIỆN CHÍNH PHỦ ĐIỆN TỬ TẠI VIỆT NAM Lộ trình xây dựng Chính phủ điện tử Việt Nam qua ... nhìn Chính phủ điện tử, nhƣ tìm hiểu hình Chính phủ điện tử nƣớc giới, đánh giá mặt đƣợc chƣa đƣợc việc triển khai Chính phủ điện tử Việt Nam ĐỊNH NGHĨA VỀ CHÍNH PHỦ ĐIỆN TỬ 1.1 Chính phủ điện...
  • 87
  • 1,507
  • 9

NGHIÊN CỨU RUỒI ĐỤC QUẢ PHƯƠNG ĐÔNG, HẠT XOÀI SAU THU HOẠCH MIỀN NAM ĐỀ XUẤT BIỆN PHÁP PHÒNG TRỪ CHÚNG ĐỐI VỚI XOÀI XUẤT KHẨU

NGHIÊN CỨU RUỒI ĐỤC QUẢ PHƯƠNG ĐÔNG, HẠT XOÀI SAU THU HOẠCH Ở MIỀN NAM VÀ ĐỀ XUẤT BIỆN PHÁP PHÒNG TRỪ CHÚNG ĐỐI VỚI XOÀI XUẤT KHẨU
... xử lý ruồi 4.2 Phạm vi nghiên cứu sống xoài Cát Chu không khí nóng (ở mức 42 - - Thành phần loài ruồi đục xoài sau thu hoạch vùng trồng xoài miền Nam Việt Nam 470C) 1.6 Biện pháp xử lý trừ ruồi ... lớn ruồi khâu vận hành tốn nhiều công lao động: lồng nuôi trởng gây hại xoài sau thu hoạch miền Nam đề xuất biện pháp phòng thành kéo dài 1,5 tháng, tổng thời gian khai thác trứng 24 ngày trừ chúng ... trớc sau thu hoạch; qui trình thu hoạch chuẩn bị xử lý biện pháp KDTV trừ ruồi đục cho xoài Cát Chu; kinh nghiệm phân tích nguy hàng hóa với nớc nhập 1.4 Nhận xét chung vấn đề quan tâm Để trừ ruồi...
  • 14
  • 674
  • 4

Nghiên cứu, xây dựng kế hoạch phát triển chăn nuôi tiêu thụ sản phẩm lợn bản địa

Nghiên cứu, xây dựng kế hoạch phát triển chăn nuôi và tiêu thụ sản phẩm lợn bản địa
... nghiệm phát triển chuỗi giá trị chăn nuôi để triển khai hoạt động nghiên cứu xây dựng kế hoạch sản xuất tiêu thụ lợn địa xã vùng cao thuộc hai huyện Mường Khương Bát Xát tỉnh Lào Cai II MỤC TIÊU ... lợn địa thời gian tới III SẢN PHẨM YÊU CẦU - Báo cáo kết nghiên cứu, khảo sát điều kiện tổ chức sản xuất thị trường tiêu thụ sản phẩm lợn đen địa huyện địa bàn tỉnh Lào Cai (Trong có rõ qui mô chăn ... dụng phù hợp với địa phương - Thảo luận, tư vấn xác định kết mong đợi cho ngành hàng lợn địa Lào Cai (xác định rõ khung thời gian) - Xây dựng kế hoạch sản xuất, tiêu thụ lợn đen địa địa bàn huyện...
  • 4
  • 1,193
  • 6

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...
  • 11
  • 258
  • 0

Nghiên cứu xây dựng giải pháp phát triển thị trường thức ăn chăn nuôi

Nghiên cứu xây dựng giải pháp phát triển thị trường thức ăn chăn nuôi
... Nhập thức ăn chăn nuôi nguyên liệu cho chế biến thức ăn chăn nuôi Việt Nam theo thị trường: + Giá trị nhập khẩu: Tổng kim ngạch nhập thức ăn chăn nuôi nguyên liệu cho chế biến thức ăn chăn nuôi ... Chương 1: Thực trạng ngành chăn nuôi Việt Nam Chương 2: Thực trạng thị trường thức ăn chăn nuôi Việt Nam Chương 3: Một số giải pháp phát triển thị trường thức ăn chăn nuôi Việt Nam giai đoạn 2010 ... pháp phát triển thị trường thức ăn chăn nuôi cần thiết có ý nghĩa quan trọng việc bình ổn thị trường thức ăn chăn nuôi Kết nghiên cứu Đề tài sở giúp Chính phủ, Bộ, ngành, địa phương xây dựng...
  • 100
  • 321
  • 1

Nghiên cứu xây dựng lộ trình nâng cao năng suất chất lượng sản phẩm hàng hoá công nghiệp chủ lực

Nghiên cứu xây dựng lộ trình nâng cao năng suất và chất lượng sản phẩm hàng hoá công nghiệp chủ lực
... địa hoá Trong LILAMA qui tụ Viện nghiên cứu, đơn vị t vấn chuyên ngành Nhà máy chế tạo thiết bị Bộ Công nghiệp trớc đây, Bộ Công Thơng, Bộ xây dựng, Trờng Đại học Bách khoa, Trờng đại học Xây dựng ... lớn Dự án tập trung vào công việc phức tạp nghiên cứu công nghệ sản xuất công nghệ chế tạo thiết bị lần đợc thực Việt Nam theo hình thức quản lý mới: có gắn kếttrực tiếp nghiên cứu khoa học chế ... Công ty Cổ phần Thuỷ điện Sông Vàng đợc ký ngày 6/11, Hà Nội b Tổng Công ty Máy thiết bị công nghiệp (MIE) - Tổng Công ty Cơ khí xây dựng (COMA) - Viện Nghiên cứu khí (Narime) Trong năm cuối...
  • 85
  • 284
  • 0

Xây dựng lộ trình phát triển nghề nghiệp cho nhân viên potx

Xây dựng lộ trình phát triển nghề nghiệp cho nhân viên potx
... đưa quy trình giúp nhà quản lý xây dựng kế hoạch phát triển nghề nghiệp cho nhân viên cách thực bước đơn giản sau Báo cho nhân viên biết có trao đổi, thảo luận kế hoạch phát triển nghề nghiệp ... nhân viên Sếp nên tạo điều kiện thuận lợi cho nhân viên để họ theo đuổi, khám phá lựa chọn phát triển nghề nghiệp Sếp tạo hội cho nhân viên phát triển nghề nghiệp có thể, khuyến khích nhân viên ... đường phát triển nghề nghiệp, mục tiêu cá nhân thăng tiến nhân viên Không nên đóng vai trò người “sở hữu” chịu trách nhiệm việc triển khai kế hoạch phát triển nghề nghiệp cho nhân viên Kế hoạch nhân...
  • 6
  • 1,139
  • 16

NGHIÊN CỨU XÂY DỰNG QUY TRÌNH PHÁT HIỆN XÁC ĐỊNH HÀM LƯỢNG MỘT SỐ CHẤT BỊ CẤM SỬ DỤNG TRONG MỸ PHẨM

NGHIÊN  CỨU  XÂY  DỰNG  QUY TRÌNH PHÁT HIỆN VÀ XÁC ĐỊNH  HÀM LƯỢNG  MỘT  SỐ  CHẤT  BỊ  CẤM SỬ DỤNG TRONG MỸ PHẨM
... chất lượng mỹ phẩm theo Thông tư 06/2011/TT-BYT 1.2 MỘT SỐ HỢP CHẤT CẤM SỬ DỤNG VÀ CẦN KIỂM SOÁT HÀM LƯỢNG NGHIÊN CỨU TRONG ĐỀ TÀI 1.2.1 Một số hợp chất màu bị cấm sử dụng mỹ phẩm 1.2.2 Một số ... BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ TRƯỜNG ĐẠI HỌC DƯỢC HÀ NỘI LÊ THỊ HƯỜNG HOA NGHIÊN CỨU XÂY DỰNG QUY TRÌNH PHÁT HIỆN VÀ XÁC ĐỊNH HÀM LƯỢNG MỘT SỐ CHẤT BỊ CẤM SỬ DỤNG TRONG MỸ PHẨM CHUYÊN NGÀNH: ... thành phần cần ý 1.2 MỘT SỐ HỢP CHẤT BỊ CẤM SỬ DỤNG VÀ CẦN KIỂM SOÁT HÀM LƯỢNG NGHIÊN CỨU TRONG ĐỀ TÀI 1.2.1 Một số hợp chất màu bị cấm sử dụng mỹ phẩm Các hợp chất màu chất có màu trạng thái...
  • 218
  • 711
  • 1

Xem thêm

Từ khóa: nghiên cứu xây dựng chiến lược phát triển thể dục thể thao nước cộng hàa dân chủ nhân dân làonghiên cứu xây dựng lộ trình thực hiện bảo hiểm xã hội đối với mọi người lao động ở việt namnghiên cứu xây dựng quy trình chế biến hắc phụ bạch phụ và bào chế cao phụ tử ở quy mô pilotnghiên cứu xây dựng quy trình nhân giống hoa violet châu phi saintpaulia bằng phương pháp nuôi cấy mô tế bào pptluận văn nghiên cứu xây dựng quy trình kỹ thuật nhân giống hoa cúc cn97 bằng công nghệ nuôi cấy mô in vitronghiên cứu xây dựng ngân hàng tế bào gốc dây rốn khu vực miền nam và ứng dụng điều trị bệnh ở ngườiquan he giua vat chat va y thuc van dung trong qua trinh phat trien kinh te xa hoi o viet namnghiên cứu phát triển vaccine cúm a h5n1 ở việt nam và trên thế giớiquy luật giá trị và ý nghĩa của quy luật giá trị trong quá trình phát triển kinh tế thị trường ở việt namvị trí của cây chè trong quá trình phát triển kinh tế xã hội ở việt namquá trình phát triển kinh tế nông hộ ở việt namnghiên cứu nhu cầu đáp ứng dịch vụ chăm sóc sức khỏe người cao tuổi và thử nghiệm mô hình can thiệp cộng đồng tại huyện đông anh hà nộinghiên cứu xây dựng quy trình quản lý đầu tư ứng dụng công nghệ thông tin tại ngân hàng phát triển việt namnghiên cứu xây dựng quy trình công nghệ sản xuất tricloixiannuric axitxây dựng chương trình phát triển đô thịĐánh giá hiệu quả giao đất, giao rừng trong chương trình chi trả dịch vụ môi trường rừng tại tỉnh quảng namĐánh giá tác động của quá trình đô thị hoá đến việc quản lý và sử dụng đất tại thị trấn la hà, huyện tư nghĩa, tỉnh quảng ngãiĐánh giá việc thực hiện công tác bồi thường, giải phóng mặt bằng, hỗ trợ và tái định cư khi nhà nước thu hồi đất tại một số dự án trên địa bàn huyện bình sơn tỉnh quảng ngãiĐiều tra tình hình mắc bệnh và thử nghiệm một số thuốc phòng trị bệnh cầu trùng trên đàn gà ri lai thuộc một số xã huyện nam đàn tỉnh nghệ an1Điều tra và thử nghiêm một số phác đồ điều trị bệnh viêm tử cung trên đàn lợn nái f1 (landrace x yorkshire) nuôi tại trang trại chăn nuôi bình định xanh, thuộc xã nhơn tân, thị xã an nhơn, tỉnh bình địnhĐiều tra, đánh giá hiệu quả kinh tế của các biện pháp kỹ thuật phòng trừ cỏ dại trong sản xuất lạc vụ hè thu năm 2015 trên địa bàn huyện quảng điền tỉnh thừa thiên huếĐo lường mức độ thỏa mãn trong công việc của nhân viên văn phòng tại công ty cổ phần chứng khoán phú hưngGiải pháp mở rộng cho vay tiêu dùng tại ngân hàng nông nghiệp và phát triển nông thôn việt nam – chi nhánh quảng trịGiải pháp nâng cao chất lượng dịch vụ vận tải trên tuyến hành lanh kinh tế đông – tây tại quảng trịGiải pháp nâng cao chất lượng thủ tục hải quan đối với hàng hóa xuất nhập khẩu tại cục hải quan thừa thiên huếGiải pháp nâng cao hiệu quả sử dụng vốn tại công ty cổ phần tổng công ty thương mại quảng trịGIẢI PHÁP TĂNG CƯỜNG HUY ĐỘNG vốn tại NGÂN HÀNG NÔNG NGHIỆP PHÁT TRIỂN NÔNG THÔN VIỆT NAM – CHI NHÁNH THÀNH PHỐ ĐÔNG hà QUẢNG TRỊHoàn thiện chiến lược kinh doanh tại công ty TNHH TM thái đông anhHOÀN THIỆN CÔNG tác KIỂM SOÁT CHI đầu tư xây DỰNG cơ bản tại KHO bạc NHÀ nước QUẢNG BÌNHHoàn thiện công tác kiểm soát chi nguồn vốn bảo vệ phát triển rừng tại kho bạc nhà nước thanh hóaHoàn thiện công tác kiểm tra thuế đối với các doanh nghiệp tại chi cục thuế thị xã sầm sơnHoàn thiện công tác quản lý dự án tại ban quản lý dự án đầu tư xây dựng huyện đakrôngHoàn thiện công tác quản lý nguồn nhân lực tại trung tâm phát triển dịch vụ di tích huếHoàn thiện công tác quản lý nguồn nhân lực tại viễn thông thừa thiên huếHoàn thiện công tác quản lý nguồn vốn hỗ trợ phát triển chính thức (ODA) tại sở kế hoạch và đầu tư, tỉnh quảng trị
Nạp tiền Tải lên
Đăng ký
Đăng nhập