kỹ thuật mạng norowrron và giải thuật di truyền

Nghiên cứu phân lập tuyển chọn tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzym β-galactosidaza có hiệu suất cao

Nghiên cứu phân lập tuyển chọn và tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzym β-galactosidaza có hiệu suất cao
... nhánh: Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym -galactosidaza hiệu suất cao KC- 04-07 Mã số đề tài : Năm Theo hợp đồng Năm 2001 Đã phân lập đợc chủng ... lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym galactosidaza hiệu suất cao" Nội dung đề tài tập trung giải bốn nhiệm vụ là: + Phân lập tuyển chọn chủng vi sinh vật ... Ngô Tiến Hiển Đề tài nhánh cấp nhà nớc Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym -galactosidaza hiệu suất cao Chủ nhiệm đề tài nhánh cấp nhà nớc...
  • 30
  • 346
  • 4

Nghiên cứu phân lập tuyển chọn tạo chủng giống bằng kỹ thuật di truyền

 Nghiên cứu phân lập tuyển chọn và tạo chủng giống bằng kỹ thuật di truyền
... tốc độ bổ sung dịch vào bình lên men 20 III Kết vầ bàn luận 22 3.1 Tuyển chọn chủng giống nấm men 22 3.2 Khả tạo cồn sinh hơng của chủng chọn lựa 23 3.3 ảnh hởng tỷ lệ men giống đến trình lên ... nhân giống (1) 24 280C Năng lực lên men 14 chủng nghiên cứu đợc đánh giá dựa thời gian tạo 5ml CO2 Theo dõi thời gian tạo 5ml CO2 bình engol Kết ghi bảng Bảng Năng lực lên men 14 chủng nghiên cứu ... luận 3. 1Tuyển chọn chủng giống nấm men Thí nghiệm đợc tiến hành bình engol dung tích 5ml, dùng pipet vô trùng hút 4,5ml môi trờng sơ tuyển giống (2) vào bình engol vô trùng, tiếp 0,5ml giống đợc...
  • 41
  • 229
  • 0

DI TRUYỀN PHÂN TỬ KỸ THUẬT DI TRUYỀN ỨNG DỤNG TRONG NHÂN GIỐNG ĐỘNG VẬT

DI TRUYỀN PHÂN TỬ VÀ KỸ THUẬT DI TRUYỀN ỨNG DỤNG TRONG NHÂN GIỐNG ĐỘNG VẬT
... Kỹ thuật di truyền Kỹ thuật tái tổ hợp DNA thường gọi kỹ thuật di truyền, bao gồm tập hợp gồm nhiều kỹ thuật, vai trò hàng đầu thuộc tư phương pháp di truyền vi sinh vật, sinh học phân tử, hóa ... điểm mã di truyền - Mã di truyền mã ba, nghĩa nucleotide mã hóa cho axit amin - Mã di truyền không gối lên Thông tin phân tử mRNA đọc theo chiều 5’P - 3’OH kể từ codon khởi đầu - Mã di truyền ... đa tiềm di truyền, tức có đủ tất thông tin di truyền để tổng hợp loại kháng thể, kháng nguyên có tác dụng tác nhân kích thích cảm ứng gen tổng hợp kháng thể hoạt động - Quan điểm di truyền học...
  • 70
  • 493
  • 7

Tài liệu Lịch sử phát triển của Di truyền học Kỹ thuật di truyền doc

Tài liệu Lịch sử phát triển của Di truyền học và Kỹ thuật di truyền doc
... C S DI TRUYN M U LC S PHT TRIN CA DI TRUYN HC V K THUT DI TRUYN 1.1- LNH VC NGHIấN CU CA DI TRUYN V CễNG NGH DI TRUYN Thut ng di truyn (geneties) xut phỏt t gc latinh l gentikos (ngun gc) Di truyn ... hoc vi nguyờn t th nht (N1) ca baz pyrimidine - Nucleoside ca baz pyrimidine vi ng ribose mang tờn ca baz v cú uụi l -idine (thymidine, uridine, cytidine) - 12 - - Nucleoside ca baz purin vi ... phỏt trin ca di truyn hc v sinh hc Nm 1961, M Nirenberg v J Matthei ó xỏc nh c b mó di truyn u tiờn v sau ú, ton b cỏc b mó di truyn cng ó c tỡm 1.3- S RA I CA CễNG NGH DI TRUYN K thut di truyn i...
  • 180
  • 291
  • 1

kỹ thuật di truyền các omics

kỹ thuật di truyền và các omics
... CHƯƠNG XII KỸ THUẬT DI TRUYỀN VÀ CÁC OMICS I- KỸ THUẬT TÁI TỔ HP DNA II- CÔNG CU NGHIÊN CỨU SINH HOCÏ III- GENOMICS, PROTEOMICS VÀ CÁC OMICS KHÁC IV CÁC ỨNG DỤNG CỦA CÔNG NGHỆ ... khác có lựa chọn Có nhiều thuật ngữ đồng nghóa để kó thuật : • – Kó thuật tái tổ hợp DNA (DNA recombinant technology) • – Kó thuật di truyền (Genetic engeneering) • – Kó thuật gen (Gene engineering) ... đầu kỹ thuật di truyền Tồn DNA sinh vật cắt đoạn nhỏ khoảng 15 20.000 cặp base lắc học hay restriction endonuclease (RE) Các đoạn DNA ngắn gắn vào plasmid tái tổ hợp, mà plasmid biến nạp vào...
  • 124
  • 696
  • 5

kỹ thuật di truyền sinh học phân tử

kỹ thuật di truyền và sinh học phân tử
... trúc bao bọc tế bào, để phục vụ cho nghiên cứu ứng dụng sinh học phân tử Điều quan tâm thu nhận phân tử DNA trạng thái nguyên vẹn không bị phân hủy Cách pha hóa chất - Dung dịch đệm CTAB: + CTAB ... bảo vệ DNA khỏi phân hủy enzyme giúp bảo quản lâu Hạn chế TE có có mặt EDTA ức chế enzyme phản ứng sinh học phân tử sau Cho nên sử dụng TE nồng độ loãng, không ức chế phản ứng sinh học sau Sử dụng ... cho kết 10 Bài ĐIỆN DI TRONG GEL AGAROSE I MỤC ĐÍCH THÍ NGHIỆM Mục đích Điện di DNA gel agarose kỹ thuật dùng để kiểm tra chất lượng hàm lượng DNA Kỹ thuật dựa nguyên tắc: dựa vào đặc tính cấu trúc...
  • 20
  • 685
  • 1

Nghiên cứu phân lập tuyển chọn tạo giống bằng kỹ thuật di truyền để sinh tổng hợp pot

Nghiên cứu phân lập tuyển chọn và tạo giống bằng kỹ thuật di truyền để sinh tổng hợp pot
... tài "Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym galactosidaza có hiệu suất cao" Nội dung đề tài tập trung giải bốn nhiệm vụ là: + Phân lập tuyển chọn ... nhánh: Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym -galactosidaza có hiệu suất cao KC- 04-07 Mã số đề tài : Năm Theo hợp đồng Năm 2001 Đã phân lập đợc ... nhà nớc : PGS TS Ngô Tiến Hiển Đề tài nhánh cấp nhà nớc Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym -galactosidaza có hiệu suất cao Chủ nhiệm đề tài...
  • 30
  • 177
  • 0

Nghiên cứu ứng dụng công nghệ enzym trong chế biến một số nông sản thực phẩm ĐTN nghiên cứu phân lập tuyển chọn tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzyme bêta galactosidaza có hiệu suất cao

Nghiên cứu ứng dụng công nghệ enzym trong chế biến một số nông sản thực phẩm  ĐTN  nghiên cứu phân lập tuyển chọn và tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzyme bêta galactosidaza có hiệu suất cao
... nhánh: Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym -galactosidaza hiệu suất cao KC- 04-07 Mã số đề tài : Năm Theo hợp đồng Năm 2001 Đã phân lập đợc chủng ... tài "Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzym galactosidaza hiệu suất cao" Nội dung đề tài tập trung giải bốn nhiệm vụ là: + Phân lập tuyển chọn ... nạp tạo chủng siêu tổng hợp enzym để thu chủng sinh tổng hợp -galactosidaza hiệu suất cao + Nghiên cứu đặc tính sinh lý, sinh hoá chủng tuyển chọn, đặc tính enzym -galactosidaza chủng nghiên cứu...
  • 30
  • 245
  • 0

Nghiên cứu sản xuất protein có hoạt tính sinh học dùng trong nông nghiệp bằng kỹ thuật di truyền trên tế bào cây thông (larich desidue) bèo tấm (lema sp-wolffia sp)

Nghiên cứu sản xuất protein có hoạt tính sinh học dùng trong nông nghiệp bằng kỹ thuật di truyền trên tế bào cây thông (larich desidue) và bèo tấm (lema sp-wolffia sp)
... 1986) 1.1.4.3.Hỡnh thc sinh sn ca bốo tm Bốo tm cú hai hỡnh thc sinh sn chớnh: sinh sn vụ tớnh v sinh sn hu tớnh Sinh sn vụ tớnh chim u th so vi sinh sn hu tớnh Hỡnh thc sinh sn hu tớnh ca bốo ... trờn, Vin Di truyn Nụng nghip ó c B Khoa hc Cụng ngh cho phộp thc hin ti Nghiờn cu sn xut protein cú hot tớnh sinh hc dựng nụng nghip bng k thut di truyn trờn t bo cõy thụng (Larich desidue) ... sn xut protein cú hot tớnh sinh hc dựng nụng nghip bng k thut di truyn trờn t bo cõy thụng (Larich desidue) v bốo tm (Lemna sp/ Wolffia sp.), c thc hin trờn c s hp tỏc khoa hc vi Vin Sinh lý...
  • 138
  • 245
  • 0

BÁO CÁO NGHIÊN CỨU KHOA HỌC KỸ THUẬT: DI TRUYỀN VỀ THỜI GIAN SINH TRƯỞNG, CHIỀU CAO CÂY NĂNG SUẤT CỦA MỘT SỐ GIỐNG BÔNG potx

BÁO CÁO NGHIÊN CỨU KHOA HỌC KỸ THUẬT: DI TRUYỀN VỀ THỜI GIAN SINH TRƯỞNG, CHIỀU CAO CÂY VÀ NĂNG SUẤT CỦA MỘT SỐ GIỐNG BÔNG potx
... không cao (0,59; 0,45 0,44) cho thấy di truyền thời gian sinh trưởng, chiều cao suất bò ảnh hưởng đáng kể nhân tố môi trường Có khoảng gen (nhóm gen) kiểm soát thời gian sinh trưởng chiều cao nhóm ... nghiệp, số 1&2/2007 Đại học Nông Lâm Tp HCM NGHIÊN CỨU KHOA HỌC KỸ THUẬT 23 Bản g Giá trò W r+V r Fr giốn g theo TGST, chiều cao năn g suất TGST Giống Năn g suất bôn g hạt (tạ/ha) W r+V r Fr Chiều cao ... nghiệp, số 1&2/2007 NGHIÊN CỨU KHOA HỌC KỸ THUẬT 22 có giá trò ˆ sij cao tổ hợp có thứ hạng cao suất (từ thứ đến thứ 5) Các giống C92-52, D99-1, NH04-2 1354 có ˆ2 ˆ σsi > σ gi , phối hợp với giống...
  • 7
  • 111
  • 0

Thuyết trình kỹ thuật di truyền thư viện bộ gen ngân hàng cDNA

Thuyết trình kỹ thuật di truyền thư viện bộ gen và ngân hàng cDNA
... DUNG CHÍNH THƯ VIỆN THƯ VIỆN BỘ GEN cDNA THƯ VIỆN BỘ GEN KHÁI NIỆM QUÁ TRÌNH THÀNH LẬP KHÁI NIỆM • Thư viện gen (Ngân hàng gen) Chia nhỏ DNA gen chèn chúng vào tế bào chủ • Chứa tất DNA gen sinh ... NIỆM Thư viện cDNA (Ngân hàng cDNA) • • • Tập hợp cADN tổng hợp từ mARN Thiết lập vector (plasmid phage lambda) Đối tượng áp dụng: eukaryote KHÁI NIỆM THƯ VIỆN GEN Tập hợp phân đoạn DNA gen Chứa ... trường nuôi cấy tạo dòng thư ng là: – M9 (Thành phần dinh dưỡng xác định) – LB (Thành phần dinh dưỡng chưa xác định) SÀNG LỌC THƯ VIỆN ĐỂ NHẬN TRÌNH TỰ ĐÍCH • Sau thư viện gen tạo Các phương pháp...
  • 38
  • 370
  • 2

nghiên cứu phân lập tuyển chọn tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzym b-galactosidase có hiệu suất cao-tuyển chọn tạo chủng giống sinh tổng hợp enzym collagenase ứng dụng trong thực phẩm

nghiên cứu phân lập tuyển chọn và tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzym b-galactosidase có hiệu suất cao-tuyển chọn và tạo chủng giống sinh tổng hợp enzym collagenase và ứng dụng trong thực phẩm
... nớc Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzyme galactosidase hiệu suất cao Nghiên cứu phân lập tuyển chọn tạo chủng giống sinh tổng hợp enzyme collagenase ... tổ hợp gien, tiến hành đề tài Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzyme - galactosidase hiệu suất cao Nghiên cứu phân lập tuyển chọn tạo chủng ... thực Phòng Kỹ thuật Di truyền - Viện Công nghệ Sinh học Nghiên cứu phân lập tuyển chọn tạo chủng giống kỹ thuật di truyền để sinh tổng hợp enzyme - galactosidase hiệu suất cao 1.1 Tổng quan...
  • 44
  • 145
  • 0

Nghiên cứu áp dụng kỹ thuật di truyền phân tử để chẩn đoán bệnh di truyền phổ biến ở người Việt Nam nhằm hạn chế hiệu quả gen bệnh đề xuất hướng điều trị

Nghiên cứu áp dụng kỹ thuật di truyền phân tử để chẩn đoán bệnh di truyền phổ biến ở người Việt Nam nhằm hạn chế hiệu quả gen bệnh và đề xuất hướng điều trị
... Tên đề tài: Nghiên cứu áp dụng kỹ thuật di truyền phân tử để chẩn đoán bệnh di truvền phổ biến người V iệt N am nh ằm hạn c h ế hiệu gen bệnh đề xuất hướng điều trị M ã số: Q G -03-13 Chủ trì đề ... lượng mẫu hạn chế, chúng tòi chưa 14 đưa nhận định tỉ lệ dị hợp tử lan truyền quần thể Việt nam bước đầu xây dựng triển khai phương pháp sinh học phân tử để chẩn đoán bệnh di truyền người Bệnh nhân ... NghiÊn cưu ap dụng ky thuạt di truỵcn phân tư đẽ chân đoán bẻnh di truvển phố bicn người Việt Nam nhằm hạn chế hiệu gen bệnh đề xuất hướn° điéu iri Mã số: QG-03-13 Cơ quan q u ả n lý đề tài: Đại...
  • 48
  • 89
  • 0

Tổng hợp virút cúm mới từ virút cúm A H5N1 A H3N2 bằng kỹ thuật di truyền ngược

Tổng hợp virút cúm mới từ virút cúm A H5N1 và A H3N2 bằng kỹ thuật di truyền ngược
... NP Bm-NP-1 TATTCGTCTCAGGGAGCAAAAGCAGGGTA Bm-NP-1565R ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTT 1565+29 NA Ba-NA-1 TATTGGTCTCAGGGAGCAAAAGCAGGAGT Ba-NA-1413R ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTTT 1413+29 ... 387R: 5’-TCCACAAAGTTAAGAAGTATCAGT-3’ HA 535F: 5’-GAACAGTACATACCCAACAATA-3’ HA 997F: 5’-ATCAAACAGATTAGTCCTTGCG-3’ HA 1426F: 5’-CAAGGTCCGACTACAGCTTAGG-3’ NP NP 350R: 5’-GGTAGATGAGAGGACATATAC-3’ NP ... ATATCGTCTCGTATTAGTAGAAACAAGGCATTT 2341+29 PA Bm-PA-1 TATTCGTCTCAGGGAGCGAAAGCAGGTAC Bm-PA-2233R ATATCGTCTCGTATTAGTAGAAACAAGGTACTT 2233+29 HA Bm-HA-1 TATTCGTCTCAGGGAGCAAAAGCAGGGG Bm-NS-890R ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT...
  • 99
  • 142
  • 0

Xem thêm

Từ khóa: kỹ thuật di truyền và ứng dụng lê đình lươngtrắc nghiệm di truyền và kỹ thuật di truyềnkỹ thuật di truyền nguyên lý và ứng dụngnghiên cứu phân lập tuyển chọn và tạo chủng giống bằng kỹ thuật di truyền để sinh tổng hợp enzym βgalactosidaza có hiệu suất caokỹ thuật di truyền và các omicskỹ thuật di truyền và các omics i kỹ thuật tái tổ hp dna ii công cu nghiên cứu sinh hocï iii genomics proteomics và các omics khác iv các ứng dụng của công nghệ gen vi liệu pháp gen ở ngườibài giảng kỹ thuật di truyền thủy sảnkỹ thuật di truyền thủy sảnvai trò của re kỹ thuật di truyềnkỹ thuật di truyền họckỹ thuật di truyền tiết 2sách kỹ thuật di truyềncác kỹ thuật di truyềnkỹ thuật di truyền ngượckỹ thuật di truyền vi sinh vậtLọc ý định người dùng trong các diễn đàn, mạng xã hộiNghiên cứu và ứng dụng SEO website trường đại học sư phạm thái nguyênThiết kế và mô phỏng hệ thống phát hiện xâm nhập cho trường phổ thông dân tộc nội trú huyện tuần giáoXây dựng website quản lý nhân sự cho công ty VNPT thái nguyênXây dựng website đăng ký và học trực tuyến cho trường đại học sư phạm thái nguyênSử dụng công nghệ JSP xây dựng module quản lý chấm công nhân viên cho công ty phần mềm 2NF – software hà nộiXây dựng hệ thống hỗ trợ phân công, quản lý lịch cho giáo viên trường đại học công nghệ thông tin và truyền thôngXây dựng phần mềm tra cứu tuyến xe tại thái nguyên trên hệ điều hành androidNghiên cứu các phương pháp trích chọn sự kiện và ứng dụng vào bài toán trích chọn sự kiện dịch bệnhGiáo trình bài tập dsp midterm hki 2010 2011Giáo trình bài tập 3 đạo hàm và vi phânGiáo trình bài tập 2 động lực học chất điểmGiáo trình bài tập clctt4 bGiáo trình bài tập 3 de kt giua hk truyennhietNghien cuu moi quan heThủy vân thuận nghịch trên ảnh số và một số ứng dụng trong y tếXây dựng các lược đồ thủy vân bền vững bằng cách kểt hợp phép biến đổi DWT và SVDTìm hiểu công nghệ unity và xây dựng gameXác định độ dài khoảng trong mô hình dự báo chuỗi thời gian mờXây dừng website bán hàng cho công ty máy tính hoàng anh
Nạp tiền Tải lên
Đăng ký
Đăng nhập