Tomato compact part 7

GIẢI TOMATO COMPACT PART 7 LEAP english

GIẢI TOMATO COMPACT PART 7   LEAP english
... gốc TOMATO COMPACT Part ĐÂY Xin chân thành cám ơn tới thầy cô giảng viên TOEIC Trung Tâm Anh Ngữ LEAP English, EA bạn cộng tác viên đặc biệt thầy ĐỖ QUỐC TRUNG – Giảng viên TOEIC kiêm CEO LEAP English ... (n): mục đích w w w w L EA P ed u 176 177 178 179 180 u ed P EA w w w L Câu hỏi 176 -180 liên quan đến thư báo Đăng bởi: Carlos Fernandez Ngày: 10, tháng 7, 2008 Chủ đề: Chính sách công ty rủi ... văn phòng chúng tôi: The Canberra Opera Company Hoặc gọi: (02) 478 6- 474 7 L 155 Cái quảng cáo? EA Nhóm trường học: (02) 478 6- 474 7 P 56 Kent St., Canberra, ACT w A Công ty nhạc kịch quốc tế B Nhà...
  • 364
  • 345
  • 1

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 9 doc

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 9 doc
... POS _ _ _ _ B6 NC2 _ _ POS POS POS _ _ _ _ Phụ lục 5e: Đĩa ELISA số B: Nƣớc cất C: Buffer PC: Đối chứng dƣơng NC: Đối chứng âm - : Âm tính POS:Dƣơng tính 10 ... lục 5b: Đĩa ELISA số 2 10 B1 C1 _ _ _ _ _ _ _ _ _ B2 C2 _ _ _ _ _ _ _ _ _ B3 PC1 _ _ _ _ _ _ _ _ _ B4 PC2 _ _ _ _ _ _ _ _ _ B5 NC1 _ _ _ _ _ _ _ _ _ B6 NC2 _ _ _ _ _ _ _ _ _ Phụ lục 5C: Đĩa ELISA ... Mùa vụ Bệnh có thƣờng xảy không Triệu chứng Phụ lục 5: Kết ELISA đĩa nhƣ sau: 10 11 11 C1 _ _ _ _ _ _ _ _ C2 _ _ _ _ _ _ _ _ _ B3 PC1 _ _ _ _ _ _ _ POS _ B4 PC2...
  • 5
  • 181
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 8 pot

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 8 pot
... 6 181 6241 6301 6361 6421 6 481 6541 6601 6661 6721 6 781 684 1 6901 6961 7021 7 081 7141 7201 7261 7321 7 381 7441 7501 7561 7621 7 681 7741 780 1 786 1 7921 7 981 80 41 81 01 81 61 82 21 82 81 83 41 84 01 84 61 ... ca genome TSWV 61 121 181 241 301 361 421 481 541 601 661 721 781 84 1 901 961 1021 1 081 1141 1201 1261 1321 1 381 1441 1501 1561 1621 1 681 1741 180 1 186 1 1921 1 981 2041 2101 2161 2221 2 281 2341 ... 121 181 241 301 361 421 481 541 601 661 721 781 84 1 901 961 1021 1 081 1141 1201 1261 1321 1 381 1441 1501 1561 1621 1 681 1741 180 1 186 1 1921 1 981 2041 2101 2161 2221 2 281 2341 2401 2461 2521 2 581 ...
  • 10
  • 178
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 7 pptx

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 7 pptx
... 19 7- 2 16 92 4-9 48 19 7- 2 16 92 3-9 47 19 5-2 16 92 0-9 43 2 6-4 9 92 4-9 48 2 6-4 9 92 3-9 47 2 6-4 9 92 0-9 44 2 7- 4 9 92 4-9 47 2 7- 4 9 92 3-9 46 2 7- 4 9 92 0-9 43 2 7- 4 9 92 0-9 44 2 7- 4 9 92 4-9 48 2 7- 4 9 92 3-9 47 2 2-4 5 92 4-9 47 2 2-4 5 ... | -4 4 | -5 1 | | -4 4 | -5 3 | | -4 9 | -4 9 | | -4 9 | -5 1 | | -4 9 | -5 3 | | -4 9 | -5 1 | | -4 7 | -5 0 | | -4 7 | -5 0 | | -4 7 | -4 9 | | -4 7 | -5 1 | | -4 7 | -5 1 | | -4 7 | -5 3 | | -4 7 | -5 0 | | -4 7 | -5 0 ... -5 1 | | -4 7 | -5 3 | | -4 7 | -5 0 | | -4 7 | -5 0 | | -4 7 | -4 9 | | -4 7 | -5 1 | | -4 7 | -5 1 | | -4 7 | -5 3 | | -5 0 | -5 0 | | -5 0 | -5 0 | | -4 9 | -5 0 | | 55 | 44 | | 55 | 48 | | 59 | 46 | | 42 | 44...
  • 10
  • 188
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 6 pot

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 6 pot
... Các bƣớc thực nhƣ sau:  Bƣớc 1: Vào trang chủ NCBI  Bƣớc 2: Vào Folder Blast  Bƣớc 3: Nhập trình tự hai primer vào  Chú : Nhập nhƣ sau: Primer1 nnnnnnnnnnnnn Primer2 (lấy bổ sung đảo đầu ... Phần IV Kết Thảo luận 4.1 Mức độ nhiễm bệnh TSWV xã đại diện cho huyện qua chẩn đốn ELISA 4.1.1 Tỷ lệ nhiễm bệnh TSWV theo địa bàn điều tra Bảng 4. 1: Tỷ lệ nhiễm bệnh TSWV x : Nhuận Đức, Phƣớc ... CA-3’ (J.Morris) TSWV- CP–17F TSWV 5’ – CTCTTGATGATGCAAAGTCTGTGA– 3’ TSWV- CP–100RTSWV5’–TCTCAAAGCTATCAACTGAAGCAATAA-3’ 41 (J.Morris) TSWV7 23 CAC AAG GCA AAG ACC TTG AG 269 8-2 717b 62 0 TSWV7 22 GCT GGA...
  • 10
  • 155
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 4 ppt

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 4 ppt
... International) 2.13 Giới thiệu kỹ thuật PCR 2.13.1 Nguyên tắc kỹ thuật PCR PCR đƣợc thực sở sinh tổng hợp DNA theo nhiều chu kỳ nối tiếp nhau, chu kỳ gồm trình tự nhƣ sau : Bƣớc 1: Biến tính sợi đôi thành ... (kDa) (Michael Blaber, 1998) >95% đầu đầu 3' A đầu bằng + 94 61 + ? ? 92 94 70 27  Primer Một số tiêu thiết k - lựa chọn Primer:  Thông thƣờng primer có chiều dài 2 0- 30 mer  Không nên thiết kế ... thực phản ứng ELISA gián tiếp 2.12.2.3 Sandwich ELISA Sandwich ELISA đƣợc chia làm hai hệ thống:  Sandwich ELISA trực tiếp Cho kháng thể vào đĩa ELISA Ủ, rửa Thêm kháng nguyên vào Ủ, rửa Bổ...
  • 10
  • 145
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 3 pot

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 3 pot
... có triệu chứng bệnh điển hình biểu nhanh chóng Chẩn đoán thị phƣơng pháp xác nghiên cứu virus thực vật Cây thị đƣợc chia làm hai nhóm: nhiễm bệnh cục nhiễm bệnh hệ thống Cây nhiễm bệnh cục thƣờng ... phân lập gen kháng để chuyển vào ớt cho phép tạo tính kháng với TSWV (Ray Cerkauskas, 2004), (Ken Pernezny ctv, 20 03) 18 2.11 Chẩn đoán bệnh TSWV 2.11.1 Phƣơng pháp thị Cây thị thực chất ký chủ (có ... phòng Cây thị cách chẩn đoán quan trọng phòng thí nghiệm virus thực vật chúng sở ban đầu để chẩn đoán Nhƣợc điểm phƣơng pháp cần có thời gian lây bệnh phải chờ phát bệnh sau thời kỳ ủ bệnh ...
  • 10
  • 209
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 2 pdf

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 2 pdf
... cầu 1 .2. 1 Mục đích nghiên cứu Thực tập, ứng dụng bƣớc đầu xây dựng phƣơng pháp chẩn đoán bệnh TSWV đối tƣợng ớt mức độ phân tử, từ đánh giá đƣợc trạng nhiễm bệnh TSWV ớt địa bàn điều tra 1 .2. 2 Yêu ... thuật ELISA bước đầu xây dựng phương pháp chẩn đoán kỹ thuật RT - PCR đƣợc thực nhằm xác định sớm mầm bệnh, từ có biện pháp ngăn chặn kịp thời giảm bớt mức thiệt hại mầm bệnh gây 1 .2 Mục Đích - ... Hình 2. 1: Cấu trúc virút TSWV 11 Hình 2. 2: Sơ đồ mã dịch mã virút TSWV 12 Hình 2. 3: Chu trình xâm nhiễm virút TSWV 14 Hình 2. 4: Ớt bị nhiễm TSWV 15 Hình 2. 5:...
  • 10
  • 166
  • 0

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 1 ppsx

Luận văn : NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƯƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR part 1 ppsx
... 18 2 .11 .1 Phƣơng pháp thị 18 2 .11 .1. 1 Cây nhiễm phận 18 2 .11 .1. 2 Cây nhiễm hệ thống 18 2 .11 .2 Phƣơng pháp chẩn đoán kính hiển vi điện tử 19 2 .12 ELISA ... DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ****** NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU ... TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƢỚC ĐẦU XÂY DỰNG PHƢƠNG PHÁP CHẨN ĐOÁN BẰNG RT PCR Hội đồng hƣớng dẫn: PGS.TS BÙI CÁCH TUYẾN Đề tài đƣợc...
  • 10
  • 167
  • 0

Xem thêm

Từ khóa: tomato toeic compact part 12toefl cbt book part 7writing template part 7reading upper intermediate part 7teaching academic esl writing part 7kaplan toefl paper and pencil part 7963 bài essays mẫu part 7toefl stucture bank part 7toefl ibt listening e part 7master toefl vocabulary part 7ielts practice test plus part 7ace the toefl essay part 7how to prepare for the toefl part 74how to prepare for the toefl part 75how to prepare for the toefl part 72Các yếu tố ảnh hưởng tới lòng trung thành của cán bộ nhân viên tại ngân hàng TMCP hàng hải việt namBồi dưỡng học sinh giỏi hóa học thông qua dạy học phần điện hóa học ở trường trung học phổ thôngTHUYẾT MINH ĐỒ ÁN TỐT NGHIỆP NGÀNH XÂY DỰNG 2014Giáo án Tiếng anh lớp 3 unit7 lesson1Quản lý nguồn nhân lực tại công ty cổ phần vật tư kỹ thuật nông nghiệp bắc giangQuản lý vốn đầu tư xây dựng cơ bản từ ngân sách nhà nước của huyện nam sách, tỉnh hải dươngBiện pháp phát triển đội ngũ giáo viên các trường trung học phổ thông tỉnh hưng yên đáp ứng yêu cầu đổi mới giáo dụcBiện pháp quản lý hoạt động dạy học môn tiếng anh tại trường THPT dương quảng hàm, huyện văn giang, tỉnh hưng yên25 ĐỀ DẠNG ĐIỀN TỪ HAY CHO HỌC SINH LỚP 3, 4 LUYỆN HÈTài liệu môn học Mạng Máy Tínhtrắc nghiệm vật lý 12 học kì 2bồi dưỡng học sinh giỏi tiếng anh thpt chuyên đề integrating grammar for communicative language (3)Tài liệu ôn thi học sinh giỏi ngữ văn thpt chuyên đề nguyễn du và truyện kiều trong trang phê bình văn học của xuân diệuTài liệu ôn thi học sinh giỏi ngữ văn thpt chuyên đề PHÂN TÍCH CHI TIẾT NGHỆ THUẬT TRONG tác PHẨM tự sựĐồ án Nghiên cứu máy nén khí piston 4BY59 trong công tác khoan, khai thác dầu khí và phương pháp phục hồi cụm piston, xi lanh của máy nén khí 4BY59Bài thuyết trình Hóa học ứng dụng: Sơn và quy trình sản xuất sơnLuận văn Biệt thự Đông DươngBài tập elipĐồ án Thiết kế máy đào gầu nghịchTiểu luận Thí nghiệm cắt trực tiếp và ảnh hưởng của điều kiện thí nghiệm lên các giá trị đặc trưng thu nhận được so với mẫu ở điều kiện tự nhiên
Nạp tiền Tải lên
Đăng ký
Đăng nhập