Huyết học truyền máu miễn dịch sinh học phân tử

Giáo án Sinh học 10 nâng cao - KHI NIỆM BỆNH TRUYỀN NHIỄM & MIỄN DỊCH potx

Giáo án Sinh học 10 nâng cao - KHI NIỆM BỆNH TRUYỀN NHIỄM & MIỄN DỊCH potx
... hỏi: - Bệnh truyền nhiễm gì? - BTN bệnh lây lan từ cá I.KN BỆNH TRUYỀN NHIỄM: KN: - Bệnh truyền nhiễm bệnh lây lan từ cá thể sang cá thể thể sang cá thể khác khác - Tác nhân gây bệnh truyền - Tác ... biệt miễn dịch ra) nằm thể dịch (máu, sản xuất để đáp lại xâm thể dịch miễn dịch tế sữa, dịch bạch huyết, dịch nước nhập kháng nguyên lạ bào: ối,…) Phân biệt miễn dịch thể dịch - MDTD: Là miễn dịch ... chết vi sinh vật Miễn dịch khả II MIỄN DỊCH: gọi gì? Thế thể chống lại tác 1/ KN: miễn dịch? Gồm có nhân gây bệnh Miễn dịch khả loại miễn dịch nào? Vd: thể chống lại tác nhân gây Miễn dịch không...
  • 9
  • 572
  • 1

Hướng dẫn học sinh thảo luận nhóm tìm hiểu về bệnh truyền nhiễm và miễn dịch - sinh học 10 cơ bản

Hướng dẫn học sinh thảo luận nhóm tìm hiểu về bệnh truyền nhiễm và miễn dịch - sinh học 10 cơ bản
... xa bệnh truyền nhiễm tuyên truyền viên bệnh truyền nhiễm cho người đĩa bàn em sinh sống Cho nên chon đề tài: Hướng dẫn học sinh thảo luận nhóm tìm hiểu bệnh truyền nhiễm miễn dịch - sinh học 10 ... B- Giải vấn đề I- Thực trạng vấn đề nghiên cứu Thực trạng: Khi chưa hướng dẫn học sinh thảo luận nhóm tìm hiểu bệnh truyền nhiễm miễn dịch, khi dạy học sinh học nói chung phần ba sinh học vi sinh ... lồng ghép tìm hiểu sinh sản vi sinh vật gây bệnh truyền nhiễm: Khi giáo viên giảng (Bài 26 Sinh sản vi sinh vật trang 102 , 103 , 104 SGK) sinh học 10 bản, học sinh nắm hình thức sinh sản vi sinh vật...
  • 12
  • 668
  • 2

SKKN Hướng dẫn học sinh thảo luận nhóm tìm hiểu về bệnh truyền nhiễm và miễn dịchSinh học 10 Cơ bản

SKKN Hướng dẫn học sinh thảo luận nhóm tìm hiểu về bệnh truyền nhiễm và miễn dịch – Sinh học 10 Cơ bản
... xa bệnh truyền nhiễm tuyên truyền viên bệnh truyền nhiễm cho người đĩa bàn em sinh sống Cho nên chon đề tài: Hướng dẫn học sinh thảo luận nhóm tìm hiểu bệnh truyền nhiễm miễn dịch - sinh học 10 ... trạng: Khi chưa hướng dẫn học sinh thảo luận nhóm tìm hiểu bệnh truyền nhiễm miễn dịch, khi dạy học sinh học nói chung phần ba sinh học vi sinh vật nói riêng thi em học sinh hiểu bệnh lơ mơ chưa ... …………………………………… Từ sinh sản vi sinh vật lồng ghép tìm hiểu sinh sản vi sinh vật gây bệnh truyền nhiễm: Khi giáo viên giảng (Bài 26 Sinh sản vi sinh vật trang 102 , 103 , 104 SGK) sinh học 10 bản, học sinh nắm...
  • 17
  • 243
  • 1

Một số đặc tính sinh hoá, miễn dịchsinh học phân tử của các chủng Bacillus du và NT trong sản xuất các sinh phẩm

Một số đặc tính sinh hoá, miễn dịch và sinh học phân tử của các chủng Bacillus du và NT trong sản xuất các sinh phẩm
... N D u T u T u Du NT 24 + + - + 48 16 + + + + 1/8 1/16 1/32 1/64 NT Du NT Du NT Du NT - + - - - - - - - + - + - - - - 3.5 ¶nh h−ëng cđa Oligo-alginat lªn tèc ®é nh©n sinh khèi cđa Bacillus SLVK ... 108/ ml hçn dÞch Sè l−ỵng bµo tư x 108/ ml hçn dÞch Sè l−ỵng bµo tư x 108/ ml hçn dÞch Du NT Du NT Du NT Du NT - - 25 34 32 27 35 36 51 63 60 55 64 58 23 28 22 25 30 23 GTTB - - 30,3 32,6 58 59 ... tư x 10 / bµo tư x ( 0C) 108/ ml hçn ml hçn dÞch ml hçn dÞch 108/ ml hçn dÞch dÞch Du 320C NT Du NT Du NT Du NT 59 65 140 152 271 272 78 81 81 79 84 82 177 172 176 185 274 266 GTTB 73 77 163 171...
  • 30
  • 315
  • 1

Nghiên cứu một số đặc điểm dịch tễ học phân tửsinh trùng sốt rét kháng thuốc và hiệu lực của hai phác đồ điều trị tại miền Trung - Tây Nguyên (2001 - 2005)

Nghiên cứu một số đặc điểm dịch tễ học phân tử ký sinh trùng sốt rét kháng thuốc và hiệu lực của hai phác đồ điều trị tại miền Trung - Tây Nguyên (2001 - 2005)
... phối hợp thuốc, thực đề tài: Nghiên cứu số đặc điểm dịch tễ học phân tử sinh trùng sốt rét kháng thuốc hiệu lực hai phác đồ điều trị miền Trung Tây Nguyên (2001 2005) Mục tiêu đề tài - Xác định ... lệ sinh trùng sốt rét mang gen đột biến kháng thuốc số đột biến gen kháng, đơn vị Quân đội miền Trung - Tây Nguyên (2001 - 2005) - Đánh giá hiệu lực hai phác đồ điều trị sốt rét kháng thuốc: ... đột biến kháng thuốc số đột biến gen kháng, số đơn vị Quân đội miền Trung - Tây Nguyên (2001 - 2005) 3.1.1 Đặc điểm bệnh sốt rét sinh trùng sốt rét kháng thuốc 3.1.1.1 Đặc điểm mắc sốt rét lâm...
  • 27
  • 491
  • 2

Phát hiện DNA phôi thai trong máu mẹ bằng kỹ thuật sinh học phân tử nhằm chẩn đoán và đánh giá một số bệnh di truyền

Phát hiện DNA phôi thai trong máu mẹ bằng kỹ thuật sinh học phân tử nhằm chẩn đoán và đánh giá một số bệnh di truyền
... quan gia s lng DNA phụi thai t tun hon m vi tui thai [23,44,58] Vi trng hp mang thai bỡnh thng, cú th phỏt hin c DNA phụi thai huyt tng thai ph t tun thai th [35] Hn na, DNA phụi thai huyt tng ... lng DNA phụi thai t cỏc mu huyt c bo qun ụng lnh ca thai ph mang thai nam b trisomy 18, thai ph mang thai nam b trisomy 13 v thai ph bỡnh thng lm chng (ó c chn la phự hp v tui thai, gii tớnh thai ... tin s sy thai liờn tip hay thai lu Khụng cú ý nh phỏ thai i tng cn chn :tui thai tớnh theo ngy kinh cui 16 Thai t 612 tun (n=45) 26 thai ph: 67 tun (11 thai ph tun, 15 thai ph tun) 14 thai ph:...
  • 77
  • 413
  • 1

Y học Cổ truyền với miễn dịch và khả năng kháng khuẩn (Kỳ 1) pps

Y học Cổ truyền với miễn dịch và khả năng kháng khuẩn (Kỳ 1) pps
... thể phát sinh phản ứng miễn dịch mạnh, bệnh miễn dịch tự thân (luput ban đỏ), chức miễn dịch thể suy giảm mà phản ứng miễn dịch kháng nguyên giảm khả chống viêm nhiễm Đối với chứng bệnh, đa phần ... tác dụng ức chế chức miễn dịch thể vừa ức chế vừa hỗ trợ, tức ức chế miễn dịch có tác dụng tăng cường miễn dịch Phù - trừ tà nguyên tắc điều trị quan trọng Y học Cổ truyền, phương pháp để giải ... chế miễn dịch 2.2 Tác dụng điều tiết miễn dịch thuốc phù - Trung y cho “Hư tắc bổ” Nhưng hư chứng có hay suy giảm chức miễn dịch? Có số người cho rằng, phù tiền đề cho tăng cường công miễn dịch...
  • 5
  • 128
  • 0

Y học Cổ truyền với miễn dịch và khả năng kháng khuẩn (Kỳ 2) ppt

Y học Cổ truyền với miễn dịch và khả năng kháng khuẩn (Kỳ 2) ppt
... tễ” th y bệnh nhân v y nến thể thông thường có tác dụng tăng cường miễn dịch dịch thể miễn dịch tế bào Trong năm gần đ y, hoàng kỳ dùng làm thuốc bổ khí dùng điều trị bệnh tạo keo ng y nhiều ... giảm chức miễn dịch rõ rệt Vì v y, dùng phương thuốc phù để bổ dưỡng thu hiệu qủa định 2.3.Tác dụng điều tiết miễn dịch thuốc trừ tà: Theo Y học cổ truyền: Tà thực l y trừ tà chủ để điều trị, tức ... khả xúc tiến chuyển hóa limpho bào, kích thích phản ứng miễn dịch tế bào hình thành kháng thể Thực tiễn lâm sàng chứng minh loại bệnh thuộc hư chứng , dù mức độ khác , có suy giảm chức miễn dịch...
  • 5
  • 85
  • 0

Y học Cổ truyền với miễn dịch và khả năng kháng khuẩn (Kỳ 3) pps

Y học Cổ truyền với miễn dịch và khả năng kháng khuẩn (Kỳ 3) pps
... hợp miễn dịch, từ ức chế có hiệu phản ứng miễn dịch 2.3.2 Tác dụng tăng cường miễn dịch thuốc trừ tà: + Căn vào nghiên cứu thực nghiệm hội chứng "thực chứng" người ta nhân th y số thuốc hoạt huyết ... tiêu miễn dịch tế bào, globulin miễn dịch, chức tế bào limpho có chuyển biến tốt.Tác giả rút kết luận: lôi công đằng có tác dụng chống viêm, điều tiết công miễn dịch Những nghiên cứu Viện Y Thiên ... phương”, “lương huyết giải độc thang”, “long đờm thảo tả can thang” + Những báo cáo lâm sàng tác dụng tăng cường miễn dịch thuốc trừ tà ng y nhiều, thực nghiệm chưa đ y đủ Tuy nhiên, người ta...
  • 5
  • 95
  • 0

Bài giảng sinh học phân tử hóa mô miễn dịch

Bài giảng sinh học phân tử hóa mô miễn dịch
... kháng thể) kết hợp với hóa chất 1 ĐẠI CƯƠNG HÓA MÔ MIỄN DỊCH ‟ LỊCH SỬ PHÁT TRIỂN  1940s: Coons (miễn dòch hùynh quang) Chất phát huỳnh quang Kháng thể Kháng nguyên - đông lạnh, - cần trang ... tắc kỹ thuật hóa miễn dòch Hệ thống phát Hệ thống phát „ Men + Chất màu (DAB : màu vàng nâu) „ (EAC : màu đỏ) CÁC KỸ THUẬT MIỄN DỊCH MEN • Miễn dòch men trực tiếp: „Kháng nguyên (mô) + kháng ... Biết hóa miễn dịch • Biết ứng dụng chẩn đốn • Biết ứng dụng tiên lượng số bệnh ung thư • Biết ứng dụng điều trị số bệnh ung thư • Biết điều kiện đánh giá kết nhuộm hạn chế phương pháp HÓA MÔ MIỄN...
  • 108
  • 239
  • 1

Môn miễn dịch học phân tử - Vấn đề:Vacxin

Môn miễn dịch học phân tử  - Vấn đề:Vacxin
... phẩm vắc-xin Thí dụ phụ gia Freund, nhôm hyđrôxít, nhôm phosphate trộn lẫn văc-xin với - Loại phản ứng miễn dịch tượng chuyển hướng miễn dịch: tác nhân gây bệnh ngoại bào, đáp ứng miễn dịch dịch ... khoa học thống kê.) Tính hiệu vắc-xin biểu mặt chất (đáp ứng miễn dịch không thích hợp) mặt lượng (không có đáp ứng miễn dịch) Nguyên nhân gây hiệu lượng: - Các "lỗ hổng" kho tàng miễn dịch: ... bảo vệ 4.2.Tai biến dùng vắc-xin Có hai loại tai biến: nhiễm bệnh bệnh miễn dịch 4.2.1 Nhiễm bệnh - Vắc-xin sống, giảm độc lực gây bệnh cho người bị suy giảm miễn dịch - Nguy hồi phục tác nhân vi...
  • 15
  • 239
  • 0

Môn miễn dịch học phân tử Vấn đề:Vacxin

Môn miễn dịch học phân tử Vấn đề:Vacxin
... Loại phản ứng miễn dịch tượng chuyển hướng miễn dịch: tác nhân gây bệnh ngoại bào, đáp ứng miễn dịch dịch thể thích hợp (loại đáp ứng hỗ trợ tế bào lympho Th1) Ngược lại, đáp ứng miễn dịch tế bào ... khoa học thống kê.) Tính hiệu vắc-xin biểu mặt chất (đáp ứng miễn dịch không thích hợp) mặt lượng (không có đáp ứng miễn dịch) Nguyên nhân gây hiệu lượng: - Các "lỗ hổng" kho tàng miễn dịch: ... uốn ván v.v Nguyên tắc thay đổi: gây miễn dịch vi khuẩn virus giảm độc lực, với proteinđặc hiệu có tính kháng nguyên để gây đáp ứng miễn dịch, tạo trí nhớ miễn dịch đặc hiệu, tạo hiệu đề kháng cho...
  • 15
  • 127
  • 0

SKKN - Hình thành kĩ năng sống cho HS qua dạy bài "bệnh truyền nhiễm va miễn dịch" - sinh 10NC

SKKN - Hình thành kĩ năng sống cho HS qua dạy bài
... khăn trải bàn - thuật 635 (XYZ) - thuật bể cá - thuật phòng tranh - thuật công đoạn - thuật mảnh ghép - thuật động não - thuật x3 x3 - thuật trình bày phút - thuật chúng ... sống không tự nhiên có mà hình thành trình học tập, lĩnh hội rèn luyện sống Quá trình hình thành sống diễn hệ thống GD Phân loại sống Ở Việt Nam, GD qui năm vừa qua, sống phân ... em biết - thuật hỏi trả lời - thuật hỏi chuyên gia - thuật đồ tư - thuật viết tích cực - Hoàn tất nhiệm vụ III NỘI DUNG Với học “Khái niệm bệnh truyền nhiễm miễn dịch - SGK Sinh học...
  • 6
  • 599
  • 10

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR
... trình tự gen type 6h (Hình 3.8) 78 HCV GAGGTACTTGCCACATATTGCGGCTTTCCCTCCTTGGGCGATAAGTTTGGCCC TGACCGCTCGGGCTCGGTGTCTCCAAGCTCTCAAGGGAGGAGCCCCAAGTTTTCT GAGGCATGATGCCACCCGATTGAGTTCGCCGGGAGAGTACCCATGGAGTGAGAA ... TGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCGGAGTGATT GAATATGTGACTCCGTAGATATCGAAGTCAAGTGCCCTGTCCAAAGTCTCCTGTG CCTGGAGTATTTGAAAGAAATGGGTCATGAGTACCATACGCACCCAAATGGTGG GGGCATACATAATGATGTTCCCTAACCATGAATTCACAGGAGTGTGGCGAGCGGT ... Với m c đích khuyến c o bệnh nhân lựa chọn phương pháp x c định genotype, chọn đề tài: X c định kiểu gen virus viêm gan C huyết bệnh nhân viêm gan C kỹ thuật sinh h c phân tử RT -PCR , với m c tiêu...
  • 19
  • 401
  • 1

Xem thêm

Từ khóa: hệ miễn dịch sinh họcy học cổ truyền với miễn dịchbạch cầu miễn dịch sinh học 8soạn bài bạch cầu miễn dịch sinh học 8bài 14 bạch cầu miễn dịch sinh học 8một số đặc tính sinh hoá miễn dịch và sinh học phân tử của các chủng bacillus du và nt trong sản xuất các sinh phẩmmột số đặc điểm cơ bản của hệ miễn dịch sinh họctin sinh học trong phát triển dịch tễ học phân tử một số virut gây bệnh ở ngườiphát hiện dna phôi thai trong máu mẹ bằng kỹ thuật sinh học phân tửsinh học phân tử véc tơ truyền bệnhtrac nghiem di truyen hoc va sinh hoc phan tudi truyen hoc va sinh hoc phan tuứng dụng sinh học phân tử trong bệnh lý huyết họcdi truyền và sinh học phân tửsinh hoc phan tu trong benh thieu mau hinh cau luoi liemBài 12 kiểu xâu1Bài 14 kiểu dữ liệu tệp1Bài 16 định dạng văn bảnBài 17 chương trình con và phân loạiBài 19 tạo và làm việc với bảngtích phân từng phầnTO KHAI CAP XAC NHAN TTHN MAU 2013Bài 11 bản vẽ xây dựngBài 33 kính hiển viBài 40 ancolBài tập tổ chức bằng hình thức trò chơiĐồ thị của hàm số y = ax + b (a0)Bài 8 nhật bảnBài 24 công và công suấtBài 29 bệnh và tật di truyền ở ngườiMỘT số bài tập HAY và KHÓ TRONG mùa THI THỬ 2016QUÀ 20 11 gửi đến các bạn học SINHSÁCH CHUYÊN đề PHƯƠNG PHÁP GIẢI NHANH bài tập hóa họcTuần 26 tôi yêu emunit 4 big or small
Nạp tiền Tải lên
Đăng ký
Đăng nhập