Cinque, g1 adverbs and functional heads

Tài liệu Physical health and functional ability of an elderly, population in Sri, Lanka doc

Tài liệu Physical health and functional ability of an elderly, population in Sri, Lanka doc
... females Fig Ability to perform ADL Analysis by gender Tlie Ceylon Journal of Medical Science Physical health and functional ability of an elderly population in Sri Lanka 13 Table Number and % (in parenthesis) ... Identification of health problems and functional ability of an elderly population is of importance to health planners and policy makers, as such data are likely to provide guidelines in deciding the ... carried out, using standard procedures These included: semi tandem stand, full tandem stand, rising from chair without using arms and shoulder external rotation (full) A younger member of the household...
  • 8
  • 130
  • 0

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...
  • 11
  • 208
  • 0

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf
... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB1 WhiB2 WhiB2 WhiB2 WhiB2 WhiB5 WhiB5 WhiB5 WhiB5 ... 90 90 75 60 60 45 30 30 15 WhiB1 WhiB2 WhiB3 WhiB4 WhiB5 WhiB6 WhiB7 D 0h 2h 6h 20 h 30 h 42 h Effect of GSH (10 mM) WhiB1 WhiB2 WhiB3 WhiB4 WhiB5 WhiB6 WhiB7 Effect of GSSG (10 mM) % Change in...
  • 18
  • 150
  • 0

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 182
  • 0

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc
... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level After identification of a PIN domain in the MCPIP ... shown) Of the identified proteins, 73% are proteins involved in mRNA stability, but there are also proteins involved in other cellular processes, such as actin Further studies characterizing proteins...
  • 14
  • 155
  • 0

Tài liệu Báo cáo khoa học: The Mycobacterium tuberculosis membrane protein Rv2560 ) biochemical and functional studies pdf

Tài liệu Báo cáo khoa học: The Mycobacterium tuberculosis membrane protein Rv2560 ) biochemical and functional studies pdf
... mgÆmL) 1) and 3.2 lL Na125I (100 mCiÆmL) 1) were added to lL peptide solution (1 lgÆlL) 1); 15 lL sodium bisulfite (2.75 mgÆmL) 1) and 50 lL NaI (0.16 m) were added after of reaction at 18 °C The radiolabelled ... identification of the presence of the Rv2560 proline- and glycine-rich transmembrane protein encoding gene and its transcripts in the M tuberculosis complex and clinical isolate strains, as well as the characterization ... characterization of the high-activity binding peptide (HABP) involved in the binding to and invasion of monocytes (U93 7) and type II alveolar epithelial cells (A54 9), using synthetic peptides The protein...
  • 13
  • 146
  • 0

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ATP ... et al UMP kinase from Ureaplasma parvum Swedish Research Council for the Environment, Agricultural Sciences, and Spatial Planning (FORMAS) References Pollack JD (2001) Ureaplasma parvum: an opportunity...
  • 12
  • 141
  • 0

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the helicases of the phage-encoded superfamily III proteins The ... strand and the b9 strand to the b10 strand at the bottom of the Zn-stem loop in the pRN1 prim–pol structure However, because the Zn-stem loop is a fairly self-standing structure protruding from...
  • 14
  • 171
  • 0

Tài liệu Báo cáo khoa học: Globin gene family evolution and functional diversification in annelids ppt

Tài liệu Báo cáo khoa học: Globin gene family evolution and functional diversification in annelids ppt
... Consensus Globin ⁄ DHP Ar marina A2 Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron ... marina Hb Intra Mb G dibranchiata mIV A ornata DHP CDS Intron Intron CDS Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron CDS Intron Intron CDS Intron Intron Intron Intron Intron ... circulating and noncirculating intracellular globin and extracellular globin genes in annelids: these genes probably evolved from a common globin- like gene ancestor and did not emerge independently...
  • 12
  • 179
  • 0

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx
... vector MS fragmentations of entries A and B are shown in the lower panel CYP93E1 has 24-hydroxylase activities for both b-amyrin and sophoradiol substrates b-amyrin and sophoradiol hydroxylase ... production of not only flavonoid but also of triterpene saponins is induced by elicitation as mentioned above, triterpene hydroxylase is one possible function of CYP93E1 Feeding of b-amyrin and sophoradiol ... would be improved by in situ supply of the substrate through coexpression with b-amyrin synthase In our previous studies, more than 10 mg of b-amyrin was produced by 1-L culture of yeast transformant...
  • 12
  • 214
  • 0

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... PDGF-C and -D, structure and function L J Reigstad et al endothelial growth factors (VEGF) and the family is therefore often referred to as the PDGF ⁄ VEGF family The PDGF family of growth factors ... however further understanding of how these factors interplay with other members of the cystine knot family and in particular the PDGF-A, -B, and VEGF growth factors, must be the focus of future ... PDGF-D, resulting in perivascular lymphoid cell infiltrates of the lung and fibrosis in the liver [110] Conclusions The novel members, PDGF-C and -D, of the PDGF subfamily of the cystine knot family...
  • 19
  • 134
  • 0

Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt
... added a BamHI site upstream from the ATG codon, using the 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCT GCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGA CTCACTATAGGGCGAATTGGG-3¢) Amplification was performed ... markers were supplied by Sigma Aldrich (Milan, Italy) Reagents for bacterial growth were purchased from Fluka (Milan, Italy) T4 DNA ligase and Taq polymerase were from Stratagene (La Jolla, CA, ... MT A (m) and mussel MT 10 (n) as a function of the temperature increase from 20 to 90 °C The absorbance decrease at 254 nm was reported as a fraction of the standard absorbance (absorbance at...
  • 10
  • 129
  • 0

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf

Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett 385, 21 4 22 0 Coombs, G.H (1986) Intermediary ... (19 92) Molecular characterization of cDNA encoding for adenylate kinase of rice (Oryza sativa L.) Plant J 2, 845–854 20 Brune, M., Schumann, R & Wittinghofer, F (1985) Cloning and sequencing of...
  • 9
  • 115
  • 0

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig ... CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively The PCR ... 31 Itadani, H., Nakamura, T., Itoh, J., Iwaasa, H., Kanatani, A. , Borkowski, J., Ihara, M & Ohta, M (1998) Cloning and characterization of a new subtype of thyrotropin-releasing hormone receptors...
  • 11
  • 136
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập