Tài liệu Phác đồ cấp cứu sốc phản vệ pptx

Tài liệu Phác đồ cấp cứu sốc phản vệ pptx
... da theo phác đồ y, bác sỹ mặt - Hỏi kỹ tiền sử dị ứng chuẩn bị hộp thuốc cấp cứu sốc phản vệ trước dùng thuốc cần thiết SỐC PHẢN VỆ Ts.Bs Bế Hồng Thu I.CƠ CHÊ: Sốc phản vệ (Anaphylaxis) phản ứng ... vong Sốc dạng phản vệ (Anaphylactoid) phản ứng giải phóng chất trung gian không qua IgE mà trực tiếp từ tế bào mast theo nhiều chế khác (bảng 01) Biểu lâm sàng sốc phản vệ sốc dạng phản vệ giống ... bệnh nhân nằm chỗ Thuốc: Adrenalin thuốc để chống sốc phản vệ - Adrenalin dung dịch 1/1.000, ống ml = mg, tiêm da (hoặc TB) sau xuất sốc phản vệ với liều sau: 1/2-1 ống người lớn Không 0,3 ml...
  • 10
  • 2,232
  • 26

phác đồ cấp cứu sốc phản vệ

phác đồ cấp cứu sốc phản vệ
... dùng Adrenaline da theo phác đồ bác sỹ mặt * Hỏi kỹ tiền sử dị ứng chuẩn bị hộp thuốc cấp cứu sốc phản vệ trước dung thuốc cần thiết NỘI DUNG HỘP THUỐC CẤP CỨU CHỐNG SỐC PHẢN VỆ ( Kèm theo thông ... (Solumedrol 40mg Depersolon 30mg 02 ống) Phương tiện khử trùng(bông, băng, gạc, cồn) Dây garo Phác đồ cấp cứu sốc phản vệ ... 2mg/kg/4giờ Hydrocortisone * Hemisuccinate 5mg/kg/giờ tiêm tĩnh mạch (có thể tiêm bắp cấp sở) Dùng liều cao sốc nặng (gấp 2- lần) * Natriclorua 0.9% 1- lít người lớn, không 20ml/kg trẻ em * Diphenhydramine...
  • 3
  • 4,897
  • 63

Đề tài: Nghiên cứu áp dụng phác đồ chuyển insulin truyền tĩnh mạch sang đường tiêm dưới da trong kiểm soát đường huyết sau giai đoạn cấp cứu ở bệnh nhân đái tháo đường

Đề tài: Nghiên cứu áp dụng phác đồ chuyển insulin truyền tĩnh mạch sang đường tiêm dưới da trong kiểm soát đường huyết sau giai đoạn cấp cứu ở bệnh nhân đái tháo đường
... tăng áp lực thẩm thấu - Điều trị bệnh cấp tính - Truyền insulin tĩnh mạch theo phác đồ, theo dõi 4872h trì đờng huyết giới hạn mục tiêu - ổn định bệnh cấp tính - Bệnh nhân đủ tiêu chuẩn chuyển ... Bệnh nhân đủ tiêu chuẩn chuyển sử dụng insulin đờng tiêm dới da Sử dụng insulin tiêm dới da theo phác đồ, theo dõi đờng máu mao mạch lần/24h 48 đầu Đa vào nghiên cứu, thu thập số liệu 44 D Kin Kết ... sang tiờm di da mc dự ó cú mt s hng dn ca ADA v ny [11] 6.3.1 Phỏc chuyn insulin truyn tnh mch sang ng tiờm di da cỏc bnh nhõn nuụi dng tnh mch [21,24,39,85]: Phỏc chuyn sang ng tiờm di da...
  • 62
  • 776
  • 5


... l VTC nng IV iu tr: Cỏc nguyờn tc chung: - iu tr kt hp ni ngoi khoa: hi sc ni khoa v theo dừi din tin VTC ch nh can thip ngoi khoa thớch hp 41 42 - tuyn ty ngh ngi trỏnh kớch thớch ty bng thuc ... gim triglycerid mỏu (dựng sau 48 gi) Ch nh can thip ngoi khoa: - Khi cú nghi ng chn oỏn,khụng loi c bnh ngoi khoa khỏc - Cú bin chng ngoi khoa nh xut huyt ni, viờm phỳc mc, ỏp xe ty, hoi t nhim ... chn ngoi khoa: Chy mỏu t e da tớnh mng Truyn > 5v mỏu/ 24h m huyt ng khụng n nh Tn thng quỏ ln (>2cm) hoc v trớ khú cm mỏu bng NS Chy mỏu tỏi phỏt iu tr ni soi ln tht bi iu tr ni khoa tớch...
  • 106
  • 1,754
  • 12

Phác đồ cấp cứu shock phản vệ pdf

Phác đồ cấp cứu shock phản vệ pdf
... dùng Adrenaline da theo phác đồ bác sỹ mặt * Hỏi kỹ tiền sử dị ứng chuẩn bị hộp thuốc cấp cứu sốc phản vệ trước dung thuốc cần thiết NỘI DUNG HỘP THUỐC CẤP CỨU CHỐNG SỐC PHẢN VỆ ( Kèm theo thông ... 40mg Depersolon 30mg 02 ống) Phương tiện khử trùng(bông, băng, gạc, cồn) Dây garo 7 Phác đồ cấp cứu sốc phản vệ ... Methylprednisolon 1- 2mg/kg/4giờ Hydrocortisone * Hemisuccinate 5mg/kg/giờ tiêm tĩnh mạch (có thể tiêm bắp cấp sở) Dùng liều cao sốc nặng (gấp 2- lần) * Natriclorua 0.9% 1- lít người lớn, không 20ml/kg trẻ...
  • 4
  • 911
  • 5

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hô hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hô hấp ở Việt Nam

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hô hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hô hấp ở Việt Nam
... Nớc Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phơng pháp chẩn đoán sớm, phác đồ điều trị hiệu dự phòng bệnh vi m đờng hấp cấp vi rút H5N1, vi rút cúm A vi rút hợp bào hấp Vi t Nam Đề tài ... biện pháp phòng chống bệnh vi m đờng hấp cấp vi rút cúm H5N1, vi rút cúm A vi rút hợp bào hấp Phần A: Vi m đờng hấp cấp vi rút cúm a v vi rút cúm a/ h5n1 Chơng Tổng quan 1.1 Khái niệm cúm ... PCR (bp) mồi NP_F NP_R 69 ggaattcatggcgtctcaaggcaccaaa 71 tcccccgggtcaattgtcatattcctctgc N1_F GGAATTCATGAATCCAAATCAGAAGATAATAACCATT N1_R TCCCCCGGGCTACTTGTCAATGGTGAAT 1573 Thành phần phản ứng...
  • 272
  • 351
  • 2

Phác đồ cấp cứu sốc phản vệ pptx

Phác đồ cấp cứu sốc phản vệ pptx
... phân tử sẵn có - Điều dưỡng sử dụng Adrenaline da theo phác đồ y, bác sỹ mặt - Hỏi kỹ tiền sử dị ứng chuẩn bị hộp thuốc cấp cứu sốc phản vệ trước dùng thuốc cần thiết ... Methylpretnisolone mg/kg/ hydrocortisone hemisuccinate mg/kg/ tiêm tĩnh mạch tiêm bắp Dùng liều cao sốc nặng (gấp - lần) - Natriclorua 0,9% - lít người lớn, không 20 ml/ kg trẻ em - Diphenhydramine ... Nếu sốc nặng đe doạ tử vong, đường tiêm da tiêm Adrenalin dung dịch 1/10.000 (pha loãng 1/10) qua tĩnh...
  • 3
  • 582
  • 10


... cao,ủ ấm.nằm nghiêng có nôn 3, Thuốc : -ADRENALINE ống 1ml=1mg(d d1/1000) tiêm da sau xuất sốc phản vệ với liều : Người lớn :1/2-1 ống Trẻ em: không 0,3ml [ ống 1ml (1mg) + 9ml nước cất = 10ml ... adrenaline liều 10-15 phút /lần huyết áp trở lại bình thường - Theo dõi huyết áp 10-15 phút /lần - Nếu sốc nặng đe doạ tử vong ,ngoài đường tiêm da tiêm adrenaline d d 1/1000 (pha loãng 1/10) qua tĩnh...
  • 4
  • 818
  • 3

Phác đồ cấp cứu sốc phản vệ potx

Phác đồ cấp cứu sốc phản vệ potx
... cao phân tử sẵn có Điều dưỡng viên sử dụng Adrenaline da theo phác đồ BS mặt Hỏi kĩ tiền sử dị ứng chuẩn bị thuốc cấp cứu sốc phản vệ trước dùng thuốc cần thiết Test lẩy da – Prick Test Kĩ thuật ... hoặc: Hydrocortisol hemisuccinate mg/kg/giờ tiêm tĩnh mạch (có thể tiêm bắp tuyến sở) Dùng liều cao sốc nặng(gấp – lần) NaCl 0,9% – 2lit người lớn, không 20ml/kg o trẻ em Diphenhydramine – mg, tiêm ... ép chi phía chỗ tiêm đường vào nôc độc Chú ý: Theo dõi bệnh nhân 24 sau huyết áp ổn định Sau sơ cứu nên tận dụng đường tiêm TM đùi( TM to, nằm phía ĐM đùi, dễ tìm) Nếu H.A không lên sau truyền...
  • 5
  • 331
  • 0


... nhân bị choáng phản vệ - Hỏi kỹ tiền sử dị ứng chuẩn bị hộp thuốc cấp cứu sốc phản vệ trước dùng thuốc cần thiết Phác đồ cấp cứu sản khoa Bv Từ Dũ ... ngưng tim phải nhấn tim lồng ngực sốc tim Thuốc: Adrenaline thuốc để chống sốc phản vệ - Adrenaline dung dịch 1/1.000, ống 1ml = 1mg, tiêm da sau xuất sốc phản vệ với liều sau: + 1/2 – ống người ... theo phác đồ y, bác sỹ mặt - Khi bệnh nhân viện, phải dặn dò bệnh nhây kỹ lưỡng loại thuốc mà bệnh nhân bị dị ứng Ghi vào hồ sơ, sổ sức khoẻ bệnh nhân loại dị nguyên mà bệnh nhân bị choáng phản vệ...
  • 6
  • 315
  • 0

Nghiên cứu biến chứng và biểu hiện độc tính của một số phác đồ hóa chất điều trị bệnh nhân lơxêmi cấp dòng tủy

Nghiên cứu biến chứng và biểu hiện độc tính của một số phác đồ hóa chất điều trị bệnh nhân lơxêmi cấp dòng tủy
... phác đồ hóa chất cho BN lơxêmi cấp dòng tủy cần theo dõi, phát sớm 15 đánh giá mức độ biểu độc tính biến chứng phác đồ Vì thực đề tài: Nghiên cứu biến chứng biểu độc tính số phác đồ hóa chất điều ... 2 BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ TRƢỜNG ĐẠI HỌC Y HÀ NỘI ĐÀO VĂN CAO NGHIÊN CỨU BIẾN CHỨNG VÀ BIỂU HIỆN ĐỘC TÍNH CỦA MỘT SỐ PHÁC ĐỒ HÓA CHẤT ĐIỀU TRỊ BỆNH NHÂN LƠXÊMI CẤP DÒNG TỦY LUẬN VĂN THẠC ... 1: 30 lượt BN lơxêmi cấp dòng tủy điều trị phác đồ “3 + 7” - Nhóm 2: 30 lượt BN lơxêmi cấp dòng tủy điều trị phác đồ ADE - Nhóm 3: 30 lượt BN lơxêmi cấp dòng tủy điều trị phác đồ cytarabin liều...
  • 102
  • 168
  • 0

Xem thêm

Từ khóa: phác đồ cấp cứu shock phản vệphác đồ cấp cứu cơn hen phế quảnphác đồ cấp cứu ngừng hô hấp tuần hoànphác đồ cấp cứu ngừng tuần hoànphác đồ cấp cứu rắn cắnphác đồ cấp cứu điện giậtphác đồ điều trị tăng huyết áp cấp cứuphác đồ cấp cứu hen phế quản ác tínhphác đồ cấp cứu sốc phản vệ bộ y tếhồi sức cấp cứu theo phác đồphác đồ cấp cứu sốc phản vệ mới nhấtphác đồ cấp cứu sốc phản vệ 2011phác đồ cấp cứu sốc phản vệphác đồ cấp cứu say nắng say nóngphác đồ cấp cứu say nắngPhân loại phương pháp giải các dạng toán hình học 10Đề kiểm tra trắc nghiệm và tự luận hóa học 12Để học tốt ngữ văn 7Giải bài tập sinh học lớp 10Hướng dẫn học và làm bài tiếng anh 10 nâng caoNghiên cứu một số giải pháp nâng cao chất lượng cung ứng thuốc tại bệnh viện trung ương quân đội 108“Nghiên cứu cơ sở khoa học xác định các thông số kỹ thuật hợp lý cho máy trộn BTXM kiểu cưỡng bức, chu kỳ hai trục ngang do Việt Nam chế tạo”Đề thi học sinh giỏi môn vật lý lớp 61 BANON1 BANT2 banBáo cáo thực tập tại công ty du lịch Hương Giang chi nhánh Hà NộiBÀI 1 CHIẾC VÒNG bạc copyMỘT số GIẢI PHÁP NÂNG CAO CHẤT LƯỢNG MAKETING DỊCH vụ của CÔNG TY THƯƠNG mại và DỊCH vụ đất mớiỨng dụng Marketing trong kinh doanh xuất bản phẩm tại Nhà xuất bản Tài nguyên – Môi trường và Bản đồ Việt NamLớp bò sát câu hỏi chương 1 và 2 môn thực vật họcTiểu luận: Vai trò của Triết học với con ngườiẢnh hưởng của Phật giáo đối với xã hội Việt NamPhân tích mối quan hệ giữa tồn tại xã hội và ý thức xã hội. Liên hệ thực tiễnMangajin Magazine No.52
Nạp tiền Tải lên
Đăng ký
Đăng nhập