TỪ ĐIỆN KỸ THUẬT ĐIỆN TỬ PHẦN 2

Giáo trình kỹ thuật - Phương pháp phần tử hữu hạn

Giáo trình kỹ thuật - Phương pháp phần tử hữu hạn
... Phần tử bậc ba Phần tử ba chiều Phần tử tứ diện Phần tử bậc Phần tử bậc hai Phần tử bậc ba Phần tử lăng trụ SinhVienKyThuat.Com Phần tử bậc Phần tử bậc hai Phần tử bậc ba PHẦN TỬ QUY CHIẾU, PHẦN ... (gọi phần tử bậc nhất), bậc hai bậc ba v.v Dưới đây, làm quen với số dạng phần tử hữu hạn hay gặp Phần tử chiều Phần tử bậc Phần tử bậc hai Phần tử bậc ba Phần tử hai chiều Phần tử bậc Phần tử ... THIỆU PHƯƠNG PHÁP PHẦN TỬ HỮU HẠN Giới thiệu chung Xấp xỉ phần tử hữu hạn Định nghĩa hình học phần tử hữu hạn 3.1 3.2 Nút hình học Qui tắc chia miền thành phần tử...
  • 299
  • 2,443
  • 77

Nghiên cứu tính đa hình AND của các dòng vải thiều Thanh Hà bằng kỹ thuật sinh học phân tử

Nghiên cứu tính đa hình AND của các dòng vải thiều Thanh Hà bằng kỹ thuật sinh học phân tử
... dụng nghiên cứu 41 dòng vải thiều Thanh đợc thu thập huyện Thanh tỉnh Hải Dơng số dòng vải chua, vải lai vải thiều cổ thụ nông trờng Thanh Hà, Kim Bôi, Hoà Bình làm đối chứng Danh sách dòng ... Tổng số phân đoạn ADN xuất mồi 45 dòng vảI nghiên cứu; hình cách Cây: Tổng số phân đoạn ADN xuất hình v vảI toàn thu đợc từ so sánh số phân đoạn đơn dòng đa hình 26 mồi mồi Tính đa hình thể ... tính đa hình ADN dòng vải thiều Thanh 3.3.1 Phân tích tính đa hình ADN kỹ thuật RAPD Chúng tiến hành sàng lọc 80 mồi ngẫu nhiên Phòng CNTBTV cung cấp Kết chọn đợc 26 mồi dùng để đánh giá tính...
  • 93
  • 429
  • 0

Định danh nấm Phytophthora spp. bằng các kỹ thuật sinh học phân tử

Định danh nấm Phytophthora spp. bằng các kỹ thuật sinh học phân tử
... Chúng thực đề tài ” ĐỊNH DANH NẤM Phytophthora spp BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ ” nhằm hoàn thiện qui trình định danh nấm Phytophthora kỹ thuật sinh học phân tử 2 1.2 Mục đích – yêu cầu ... học phân tử ta giải khó khăn Các kỹ thuật sinh học phân tử đại với kỹ thuật như: kỹ thuật PCR, kỹ thuật sử dụng enzyme cắt, kỹ thuật đọc trình tự,… tác động lên cấu trúc phân tử DNA loài nấm từ ... ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ***** ĐỊNH DANH NẤM Phytophthora spp BẰNG CÁC KỸ THUẬT SINH HỌC PHÂN TỬ LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH:CÔNG NGHỆ SINH HỌC Giáo viên...
  • 63
  • 509
  • 5

Kỹ thuật sinh học phân tử xác định một số loài sâm thuộc chi panax

Kỹ thuật sinh học phân tử xác định một số loài sâm thuộc chi panax
... kết hợp phân tích RFLP giải trình tự phân biệt nguồn gốc mẫu K ẾT LUẬN Trong nghiên cứu này, mẫu Panax sp xác định loài phân biệt nguồn gốc nhờ kỹ thuật sinh học phân tử Nhìn chung, mẫu sâm thu ... cho thấy mẫu thuộc chi Panax Tuy nhiên, kết vùng 18S phân biệt mức loài Điều bảo tồn cao vùng loài có quan hệ gần Dựa vào kết vùng ITS, xác định loài có quan hệ gần với mẫu (bảng 1) phân biệt nguồn ... ngày, đối tượng tượng bệnh nhân cao tuổi ưu điểm Nhân sâm( 1) Một loạt kỹ thuật sinh học phân tử dùng để nghiên cứu đa dạng di truyền chi Panax random amplified polymorphism DNA (RAPD)(11), amplified...
  • 11
  • 271
  • 0

Ứng dụng kỹ thuật sinh học phần tử để xác định một số loài sâm thuộc chi Panax

Ứng dụng kỹ thuật sinh học phần tử để xác định một số loài sâm thuộc chi Panax
... biệt nguồn gốc mẫu K ẾT LUẬN Trong nghiên cứu này, mẫu Panax sp xác định loài phân biệt nguồn gốc nhờ kỹ thuật sinh học phân tử Nhìn chung, mẫu sâm thu mua từ Hàn Quốc có mức tương đồng cao mẫu thu ... dụng trị liệu không điển hình, tương đối yếu so với thuốc đặc trị Tây y việc gây tác dụng phụ sử dụng dài ngày, đối tượng tượng bệnh nhân cao tuổi ưu điểm Nhân sâm( 1) Một loạt kỹ thuật sinh học ... trình tự BLAST NCBI cho thấy mẫu thuộc chi Panax Tuy nhiên, kết vùng 18S phân biệt mức loài Điều bảo tồn cao vùng loài có quan hệ gần Dựa vào kết vùng ITS, xác định loài có quan hệ gần với mẫu (bảng...
  • 11
  • 392
  • 0

BÀI TIỂU LUẬN KỸ THUẬT SINH HỌC PHÂN TỬ VÀ BỆNH VIÊM NÃO XỐP Ở BÒ

BÀI TIỂU LUẬN  KỸ THUẬT SINH HỌC PHÂN TỬ VÀ BỆNH VIÊM NÃO XỐP Ở BÒ
... 2.2.2 Bệnh lý 12 2.3 Các kỹ thuật sinh học phân tử xác định bệnh viêm não xốp 15 III/ KẾT LUẬN 20 IV/ TÀI LIỆU THAM KHẢO 21 I/ ĐẶT VẤN ĐỀ Thời gian gần bệnh ... - BSE) hay gọi bệnh điên (Mad Cow desease) Thể bệnh giống với nhiều bệnh khác có triệu chứng cách truyền bệnh, bao gồm : bệnh gãi cừu, bệnh xốp não chồn, bệnh kuru người (xốp não tìm thấy tộc ... loại bệnh tương tự sữa, gọi bệnh điên (Mad cow) Về sau đặc điểm tổ chức tế bào bệnh, tác giả đặt tên cho bệnh Bệnh viêm não thể xốp ( Bovine Spongiform Encephalopathy - BSE) Cũng bệnh...
  • 21
  • 394
  • 1

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng cà định dạng của tập đoàn cây dó bầu ( aquilaria SP ) tại hà tĩnh

Sử dụng các kỹ thuật sinh học phân tử trong phân tích đa dạng cà định dạng của tập đoàn cây dó bầu ( aquilaria SP ) tại hà tĩnh
... giấy bầu , Trung tâm nghiên cứu Lâm đặc sản, Viện Khoa học Lâm nghiệp Việt Nam, Viện Công nghiệp giấy Cenlulose Phạm Hồng Sơn (2 00 6), Giáo trình kỹ thuật sinh học phân tử , Nhà xuất Đại học ... xứ từ Tĩnh Đây coi dấu hiệu để bước đầu phân biệt 18 cá thể bầu mà nghiên cứu dù hệ số tương đồng 18 mẫu cao ( 99,0 - 100% ) 3.5.4 Kết xác định phân tích trình tự gen ITS Kết phân tích trình ... Euphytica, (8 9), pp 257-265 18 Kiet L., Kessler PJA and Eurlings M (2 00 5), “A new species of Aquilaria (Thymelaceaceae) from Vietnam”, Blumea, (5 0), pp 135-141 19 Kress W J., Erickson D L (2 00 8), “DNA...
  • 13
  • 294
  • 0

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR

Xác định kiểu gen virut viêm gan c trong huyết thanh bệnh nhân viêm gan c bằng kỹ thuật sinh học phân tử real time – PCR
... trình tự gen type 6h (Hình 3.8) 78 HCV GAGGTACTTGCCACATATTGCGGCTTTCCCTCCTTGGGCGATAAGTTTGGCCC TGACCGCTCGGGCTCGGTGTCTCCAAGCTCTCAAGGGAGGAGCCCCAAGTTTTCT GAGGCATGATGCCACCCGATTGAGTTCGCCGGGAGAGTACCCATGGAGTGAGAA ... TGCGGCCATGCCGTGGAGTCTTTGAATGATCACTGGGAGATCAAGCGGAGTGATT GAATATGTGACTCCGTAGATATCGAAGTCAAGTGCCCTGTCCAAAGTCTCCTGTG CCTGGAGTATTTGAAAGAAATGGGTCATGAGTACCATACGCACCCAAATGGTGG GGGCATACATAATGATGTTCCCTAACCATGAATTCACAGGAGTGTGGCGAGCGGT ... Với m c đích khuyến c o bệnh nhân lựa chọn phương pháp x c định genotype, chọn đề tài: X c định kiểu gen virus viêm gan C huyết bệnh nhân viêm gan C kỹ thuật sinh h c phân tử RT -PCR , với m c tiêu...
  • 19
  • 401
  • 1

Tài liệu Nghiên cứu sử dụng công nghệ tế bào và kỹ thuật chỉ thị phân tử phục vụ chọn giống cây trồng ppt

Tài liệu Nghiên cứu sử dụng công nghệ tế bào và kỹ thuật chỉ thị phân tử phục vụ chọn giống cây trồng ppt
... Khi mơ phơi sinh thiết lập đưa vào mơi trường lỏng Tế bào non diện Những tế bào nầy xuất khơỉ đầu chọn vật liệu phơi sinh Một vài tế sản xuất polysaccharides, tế bào khơng thành phơi xuất xuất ... thermalcycler Sản phẩm PCR phân biệt nhờ điện di gel, phát nhờ phương pháp nhuộm phương pháp đánh dấu primer Kỹ thuật sử dụng theo chiến lược RAPD, DAF, AP-PCR (bảng 7-2) Kỹ thuật AFLP kỹ thuật DNA fingerprinting, ... để ứng dụng kỹ thuật chọn lọc giống lúa thơm, nhờ marker phân tử (MAS) Cho đến nay, việc lai tạo giống lúa cải tiến có phẩm chất gạo thơm thành cơng, so với việc khai thác tính trạng từ giống...
  • 51
  • 381
  • 0

Tài liệu Nghiên cứu sử dụng công nghệ tế bào và kỹ thuật chỉ thị phân tử phục vụ chọn giống cây lạc pdf

Tài liệu Nghiên cứu sử dụng công nghệ tế bào và kỹ thuật chỉ thị phân tử phục vụ chọn giống cây lạc pdf
... cáo đề tài nhánh nghiên cứu sử dụng công nghệ tế bào kỹ thuật thị phân tử phục vụ chọn tạo giống lạc Thuộc đề tài KC 04 08 Chủ trì ĐT nhánh: Ths Nguyễn Văn Thắng Cán tham gia thực đề tài: Ths ... bệnh héo xanh - Lai tạo quần thể phân li phục vụ công tác nghiên cứu đa dạng di truyền tìm kiếm thị phân tử tính kháng bệnh - Kết luận thị phân tử - Chọn số dòng /giống triển vọng kháng bệnh gỉ ... đến tháng 9/2004 Mục tiêu đề tài ứng dụng thị phân tử vào việc chọn tạo giống lạc kháng bệnh gỉ sắt/héo xanh vi khuẩn Nội dung nghiên cứu - Thu thập đánh giá tập đoàn lạc - Xác định phơng pháp đánh...
  • 8
  • 245
  • 0

CÁC ENZYME ĐƯỢC SỬ DỤNG TRONG KỸ THUẬT TẠO DÒNG PHÂN TỬ

CÁC ENZYME  ĐƯỢC SỬ DỤNG TRONG KỸ THUẬT TẠO DÒNG PHÂN TỬ
... xác định Enzyme công cụ kỹ thuật tạo dòng phân tử Sinh học phân tử phát hiểu rõ chế tác động hàng loạt enzyme, nhờ sử dụng chúng công cụ hữu hiệu việc cắt nối ghép gen Trong tạo dòng phân tử có ... tham gia enzyme: enzyme nuclease, DNA-polymerase, ligase restriction endonuclease Để hiểu thêm enzyme tạo dòng nên chọn đề tài "CÁC ENZYME ĐƯỢC SỬ DỤNG TRONG KỸ THUẬT TẠO DÒNG PHÂN TỬ " Học viên: ... với nhau, RNA ligase enzyme chủ yếu sử dụng rộng rãi Có số loại enzyme nối khác nhau, enzyme T4 DNA ligase enzyme chủ yếu sử dụng rộng rãi kỹ thuật tạo dòng DNA ligase Là enzyme xúc tác việc hình...
  • 40
  • 690
  • 7

TỂU LUẬN:KỸ THUẬT SINH HỌC PHÂN TỬ VÀ BỆNH VIÊM NÃO XỐP Ở BÒ potx

TỂU LUẬN:KỸ THUẬT SINH HỌC PHÂN TỬ VÀ BỆNH VIÊM NÃO XỐP Ở BÒ potx
... 2.2.2 Bệnh lý 12 2.3 Các kỹ thuật sinh học phân tử xác định bệnh viêm não xốp 15 III/ KẾT LUẬN 20 IV/ TÀI LIỆU THAM KHẢO 21 I/ ĐẶT VẤN ĐỀ Thời gian gần bệnh ... - BSE) hay gọi bệnh điên (Mad Cow desease) Thể bệnh giống với nhiều bệnh khác có triệu chứng cách truyền bệnh, bao gồm : bệnh gãi cừu, bệnh xốp não chồn, bệnh kuru người (xốp não tìm thấy tộc ... loại bệnh tương tự sữa, gọi bệnh điên (Mad cow) Về sau đặc điểm tổ chức tế bào bệnh, tác giả đặt tên cho bệnh Bệnh viêm não thể xốp ( Bovine Spongiform Encephalopathy - BSE) Cũng bệnh...
  • 21
  • 232
  • 1

NGUYÊN TẮC VÀ MỘT SỐ ỨNG DỤNG CỦA CÁC KỸ THUẬT SINH HỌC PHÂN TỬ CƠ BẢN

NGUYÊN TẮC VÀ MỘT SỐ ỨNG DỤNG CỦA CÁC KỸ THUẬT SINH HỌC PHÂN TỬ CƠ BẢN
... dung: Các kỹ thuật khảo sát nhiễm sắc thể Các kỹ thuật khảo sát nucleic acid Các kỹ thuật khảo sát protein Mục tiêu: Nhận diện đƣợc kỹ thuật tƣơng ứng mức độ phân tử Nêu đƣợc chế phân tử cách ... tử Nêu đƣợc chế phân tử cách phát bất thƣờng Liệt kê ứng dụng PCR giải trình tự DNA thể người quan/hệ thống Mô Tế bào Các phân tử sinh học (nucleic acid, protein) Nhiễm sắc thể Nhiễm sắc ... lƣợng lớn DNA (microgram) • Kỹ thuật phức tạp, tốn nhiều thời gian • Phần lớn ứng dụng đƣợc thay PCR 19 NORTHERN BLOT  Ứng dụng chính: Khảo sát biểu gen (RNA) mô  Kỹ thuật phức tạp, tốn thời...
  • 54
  • 350
  • 7

ĐA DẠNG DI TRUYỀN CÁC GIỐNG XOÀI (MANGIFERA SP.) BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ doc

ĐA DẠNG DI TRUYỀN CÁC GIỐNG XOÀI (MANGIFERA SP.) BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ doc
... nghiên cứu "Đa dạng di truyền giống xoài (Mangifera sp.) kỹ thuật sinh học phân tử nhằm phân loại xác định giống xoài phổ biến dựa đặc tính sinh học di truyền phân tử NGUYÊN LIỆU VÀ PHƯƠNG PHÁP ... hai giống Tương tự, xoài Bac-Tam-Bang giống xoài Hòn 100%, hai giống xoài dạng trái tròn dẹp, vỏ dày Có thể hai giống Bac-Tam-Bang Hòn giống Hai giống xoài Xiêm Mahachanoc giống 94%, hai giống ... với xoài Úc Kensington Pride, xoài Bôm, hai giống xoài đồng dạng có nguồn gốc từ Mã Lai, Châu Đại Dương Rất tiếc phân tích AFLP sử dụng giống để so sánh kết Từ khóa: AFLP, dấu phân tử, đa dạng di...
  • 11
  • 224
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập