Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan
... macromolecules will be influenced by the < /b> presence of < /b> the < /b> other type, when both are present When both the < /b> polysaccharides and < /b> the < /b> proteins gel, synergy between the < /b> two interpenetrating networks may be a useful ... can be found They are included as an appendix to the < /b> thesis -2- Chapter 1: BACKGROUND 1.1 Beta lactoglobulin β -lactoglobulin (β-lg) is the < /b> major whey protein < /b> (~50%) in the < /b> milk of < /b> ruminants and < /b> ... can be exploited in product development Objectives The < /b> objective of < /b> the < /b> present investigation was to study the < /b> influence of < /b> aggregation and < /b> gelation of < /b> β-lg on the < /b> structure < /b> and < /b> the < /b> rheology < /b> of...
  • 131
  • 47
  • 0

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... or gain -of- function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under tight control Identifying the protein structural features that account ... association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 121, 873–885 17 Yokoyama A, Wang Z, Wysocka J, Sanyal M, Aufiero DJ, Kitabayashi I, ... the other components of the MLL1 core complex catalyzes dimethylation of H3K4, we assembled the MLL1 core complex with a catalytically inactive MLL1 SET domain variant, and discovered that the...
  • 11
  • 204
  • 0

Báo cáo khoa học: Structure–function analysis of the filamentous actin binding domain of the neuronal scaffolding protein spinophilin pot

Báo cáo khoa học: Structure–function analysis of the filamentous actin binding domain of the neuronal scaffolding protein spinophilin pot
... ª 2007 FEBS 63 The actin binding domain of spinophilin H Schuler and W Peti ¨ Fig Spinophilin F -actin binding domain constructs can crosslink and cap actin polymers Polymers of actin, marked with ... study and domain borders indicated by numbers The core actin binding domain, PP1 binding domain, PDZ domain and C-terminal coiled-coil region are indicated (B, C) The sequences of human spinophilin ... 1–305 of spinophilin, bottom right panel), suggesting a polymer capping activity of spinophilin The histograms on the right show a quantitative analysis of the polymer length distributions of actin...
  • 10
  • 132
  • 0

Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx

Báo cáo y học:
... subtypes A, C, D and CRF_AE These Tat variants have been synthesized using solid phase synthesis and have been shown to be able to cross membranes and trans-activate the HIV-1 LTR except for Tat ... than the long form [15] In the NMR study of the full-length 99 residue Tat Eli, the C-terminus of Tat masks the α-helix of the glutamine-rich region [38], possibly reducing this Tat' s ability ... Multicentric Study Group: Sequence conservation and antibody cross-recognition of clade B human immunodeficiency virus (HIV) type Tat protein in HIV-1- infected Italians Ugandans and South Africans J Infect...
  • 13
  • 129
  • 0

Báo cáo khoa học: Structure of the polysaccharide chain of the lipopolysaccharide from Flexibacter maritimus pptx

Báo cáo khoa học: Structure of the polysaccharide chain of the lipopolysaccharide from Flexibacter maritimus pptx
... was eluted ahead of compound (from LPS), the a- and b-anomers of were not separated under these conditions: Yield of 1, 23 mg from O-PS, 38 mg from LPS; yield of 3, mg from LPS The acetate derivative ... distincta polysaccharide it reflects different configurations of the monosaccharides The A-B-fragment of the O-PS from F maritimus is isosteric to that of Ps distincta in the vicinity of this glycoside ... to C-7, the last chiral centre of the Ó FEBS 2003 Polysaccharide structure of F maritimus LPS (Eur J Biochem 270) 1813 Fig 1H-13C HSQC spectrum of F maritimus O-PS The anomeric signal of residue...
  • 6
  • 51
  • 0

Báo cáo khoa hoc:"Effect of the slow (K) or rapid (k +) feathering gene on body and feather growth and fatness according to ambient temperature in a Leghorn × brown egg type cross" ppsx

Báo cáo khoa hoc:
... especially concerning remiges and rectrices At one day of age, the primary and secondary feathers are like coverts in a slow feathering chick, and at eight days they not have tails Owing to the considerable ... Sheridan and Mc Donald [17] according to whom the body and feathers of the chick at weeks of age are in competition for arginin and cystein, of which the requirement is more important during the synthesis ... synthesis of feathers Feathering genes and growth performances at two temperatures 667 Table III Males in individual cages: Body measurements at 10 weeks of age according to genotype and temperature...
  • 12
  • 113
  • 0

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regions for the v-KIND–MAP2 interaction and showed that the ... both KIND1 and KIND2; DRasN, deletion of RasN; DGEF, deletion of RasGEF; KIND1, KIND1 domain; KIND2, KIND2 domain (B) KIND2 domain anchors v-KIND to dendrites Flag-tagged v-KIND, DKIND1, DKIND2,...
  • 11
  • 216
  • 0

Báo cáo khoa học: Solution structure and backbone dynamics of the XPC-binding domain of the human DNA repair protein hHR23B docx

Báo cáo khoa học: Solution structure and backbone dynamics of the XPC-binding domain of the human DNA repair protein hHR23B docx
... 2A) The N-terminal part of XPCB hHR23B B C Fig NMR structure of the XPCB domain of hHR23B (A) Stereoview of the 12 superimposed structures of XPCB hHR23B All Pro residues conserved among the ... further our knowledge with respect to the mechanisms of action of these proteins, it is crucial that we define the precise boundaries of the STI1-homologous domain and compare the structures of these ... 2467–2476 ª 2005 FEBS Dynamic structure of XPC-binding domain of hHR23B Experimental procedures Cloning and purification of the XPCB hHR23B domain The cDNAs encoding the hHR23B were generously provided...
  • 10
  • 141
  • 0

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc
... pivot about the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part of the molecule, possibly the tandem cAMP binding domains of the regulatory subunit ... secondary, tertiary, and quaternary structure packing and stability In addition, we discuss the role of charges in function of RIIa D/D MATERIALS AND METHODS Sample preparation and NMR spectroscopy ... N-terminal amide and His2 Aspartic acids Asp27 and Asp30 show lower mean pKa values than their model pKa values This may be a general property of Asp residues, as it has been observed in another...
  • 12
  • 155
  • 0

Báo cáo khoa học: Refined solution structure and backbone dynamics of the archaeal MC1 protein ppt

Báo cáo khoa học: Refined solution structure and backbone dynamics of the archaeal MC1 protein ppt
... additional DNA and the body of the protein [19] In the case of MC1 DNA complexes, we know that the protein covers at least 15 bp and that the binding site is composed of two areas of contact separated ... inwards, the arms close and the tips of the arms wrap around the DNA The amplitudes and time scales of the intramolecular motions experienced by the protein backbone are commonly determined from the ... into the nature of the dynamics, the autocorrelation functions C(t) were evaluated during the first NMR structure and backbone dynamics of MC1 10 ns, using the 20 ns trajectory time for the 93...
  • 13
  • 125
  • 0

Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx
... Ao and At are the intensities of the band of intact protein at the beginning of trypsinolysis and at the fixed time of trypsinolysis) against the time of incubation (Fig 8D) The apparent rate constants ... are same as given in (A) Point mutations of the b5–b7 loop of human HSP22 their secondary structure and on superposition of the mammalian protein sequence on the 3D structure of already crystallized ... to provide new information on the structure of sHsp and to shed new light on their role in the development of human congenital diseases Point mutations of the b5–b7 loop of human HSP22 Results...
  • 15
  • 149
  • 0

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... the same side of PAF The antifungal potency of the recombinant proteins was assessed by exposing A niger to mature PAF (mPAF), PAFK 9A, PAFK3 5A, PAFK3 8A and PAFK9,35,3 8A and carrying out a subsequent...
  • 16
  • 128
  • 0

Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebrafish (Danio rerio) potx

Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebrafish (Danio rerio) potx
... binding protein activator protein activator protein activator protein )3 4 )6 6 )1 26 )2 38 )4 35 )5 22 )7 88 )9 63 )8 77 )9 11 )1 064 )1 47 )1 091 )1 122 )1 203 )1 77 )6 72 )9 40 )2 00 )5 61 )6 60 )7 71 )8 58 )2 10 )5 97 )7 36 ... )6 60 )7 71 )8 58 )2 10 )5 97 )7 36 )9 29 ( ) ( ) + ( ) + ( ) + ( ) + ( ) ( ) ( ) + ( ) ( ) + ( ) + ( ) ( ) ( ) ( ) + ( ) ( ) ( ) + ( ) ( ) ( ) ( ) ( ) + ( ) ( ) ( ) ( ) 1.000 1.000 1.000 1.000 1.000 ... regulatory elements of the promoter and gene linkage mapping of the B-FABP gene from zebrafish (Danio rerio) Materials and methods Zebrafish culture and breeding Zebrafish were purchased from a local aquarium...
  • 11
  • 100
  • 0

Báo cáo khoa học: Structure, linkage mapping and expression of the heart-type fatty acid-binding protein gene (fabp3 ) from zebrafish (Danio rerio) pot

Báo cáo khoa học: Structure, linkage mapping and expression of the heart-type fatty acid-binding protein gene (fabp3 ) from zebrafish (Danio rerio) pot
... )2 97 )8 91 )3 33 )6 35 )6 71 )8 89 )3 63 )9 55 )7 60 )9 74 )1 099 )1 082 )1 198 ( +) ( +) ( ) ( ) ( +) ( ) ( +) ( +) ( +) ( ) ( +) ( ) ( ) ( ) ( ) ( +) ( +) 1.000 0.976 0.881 1.000 1.000 0.806 1.000 1.000 1.000 1.000 ... Denovan-Wright, E.M & Wright, J.M (200 3) Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp 7) from zebrafish (Danio rerio) Eur J Biochem 270, 715–725 ... Yin and Yang nuclear factor Y nuclear factor Y E2F, involved in cell cycle regulation E2F, involved in cell cycle regulation )5 3 )9 4 )9 02 )1 00 )2 97 )8 91 )3 33 )6 35 )6 71 )8 89 )3 63 )9 55 )7 60 )9 74 )1 099...
  • 12
  • 157
  • 0

Xem thêm

Từ khóa: the structure and functions of the red cell membrane macromolecules that carry themsize and structure of the quranthe history structure and themes of the quranthe structure and reaction processes of coal pdfthe importance of structure and process to strategy implementationthe structure and processes of the earththe structure and reaction processes of coalthe structure and process of planningthe structure and process of organizingthe structure and process of creating business messagesthe structure and process of international lawthe structure and implementation of computer programsthe study of the origin history structure and processes of the earthbasic geological concepts the structure and processes of the earththe importance of structure and process to strategy implementation business horizonsNghiên cứu phát triển đội tàu biển pha sông vận tải container ven biển Việt NamBài báo cáo tour miền tâyĐánh giá thực trạng và giải pháp nâng cao hiệu quả hoạt động của trung tâm phát triển quỹ đất tỉnh thái nguyênTEP Update_TEP Chief ExecutiveAssurance engagementBank Secrecy Act, Currency Reporting Requirements & Responding to Governmental Inquiries - Meadows Villa Waymen - Slides.PPTOrlando Orange County Convention & Visitors Burea Report11 ways To Improve business Development TemplateAngry Men Intro - student projectAccountant 1213 good exampleAdvertising for Small BusinessesSec. 194A Interest other than Interest on SecuritiesData Processing Presentation US Census OfficeNCA ChristmasReportCONTRACT COMPLIANCE TrainingActivity Funds Training - Clerks2016 ethics and patent agents - HricikCỬA TÙNGScholarship ReceptionCh 4 Notes Sensation and Perception
Đăng ký
Đăng nhập