An electromechanical impedance based method for tensile force estimation and damage diagnosis of post tensioning systems

Báo cáo khoa học: "An Endogeneous Corpus-Based Method for Structural Noun Phrase Disambiguation" pptx

Báo cáo khoa học:
... adj prep noun prep det noun adj noun prep noun noun prep noun prep noun n o u n adj noun noun noun noun prep noun noun prep noun prep noun adj noun prep noun adj adj (3) 110 91 74 53 55 73 47 27 ... no-disambiguation for the ten most frequent ambiguous structures are shown in Table (2) (1) noun noun noun noun noun noun noun 573 331 294 260 241 193 160 82 42 33 prep noun adj prep noun prep det noun adj noun ... disambiguation rules for the ambiguous parsing rule [b] : noun1 prep noun2 adj -> # nounl prep noun2 # noun, ? adj n o u n l prep noun2 detected noun2 prep noun3 detected n o u n l prep noun2 not detected...
  • 6
  • 71
  • 0

Báo cáo y học: "ISsaga is an ensemble of web-based methods for high throughput identification and semiautomatic annotation of insertion sequences in prokaryotic genomes" pdf

Báo cáo y học:
... fundamentally to such studies in two ways: firstly by enriching the ISfinder database by high throughput annotation of completely assembled and scaffold-based genomes; and secondly by direct analysis of ... and e-value 1e-5) analysis, which yields an IS prediction and generates a webbased annotation table If no ORFs are found, BLASTN is performed against the ISfinder database and any candidate ISs ... identified using manual ISfinder annotation Where annotations exist in the GenBank files, these generally only concern proteins that carry a tag ‘transposase’ with no indication of IS family If an IS family...
  • 9
  • 150
  • 0

Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx

Báo cáo hóa học:
... approximation methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H K Xu, A general iterative method for nonexpansive ... following variational inequality: f − I q, p − q ≤ ∀p ∈ Ω 3.31 Taking A I, γ and f ≡ u ∈ C is a constant in Theorem 3.1, we get the results of Iiduka and Takahashi Journal of Inequalities and Applications ... of the set of fixed points of nonexpansive mapping and the set of solutions of the variational inequality for an inverse strongly monotone mapping say x ∈ C which solves the variational inequality...
  • 16
  • 52
  • 0

Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

Báo cáo y học:
... Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis Jeffrey R Curtis1,#, John W Baddley1,2, Shuo Yang1, ... VARA visits; all other data used for the analysis were from the administrative claims data To test the performance of the effectiveness algorithm and to see whether it was similar for non-biologic ... to thank Mike Connor and Sheryl Berryman at the Birmingham VA Medical Center for their assistance in working with the DSS data This work was supported by the Agency for Research and Quality (U18...
  • 29
  • 215
  • 0


... the research gap: Can a practical investment project technology evaluation method for post -completion audits in paper production lines based on a self-assessment framework produce information which ... world forest area) Planted forests and new pulp mills as well as paper mills in Asia and South America have changed pulp and paper supply The world’s demand for paper and paperboard is currently increasing ... the quantitative and qualitative quality of an investment project This study develops a method for evaluating investment projects in a paper production line in its technological and operational...
  • 193
  • 269
  • 0

07 - immunity-based method for anti-spam model

07 - immunity-based method for anti-spam model
... application for anti-spam based on AIS to implement spam detecting And we developed some series experiments Here are the coefficients for the model as the Table showing TABLE I Parameter COEFFICIENTS FOR ... the model utilized a distributed and multi-hierarchy framework to provide an effective solution for the spam Finally, the experimental results show that the proposed model is a good solution for ... were carried out to testify the feasibility of our resolution for anti-spam as the following We prepared the Ling-Spam datasets for analysis and experiments A mixture of 481 spam messages and...
  • 4
  • 69
  • 0

Báo cáo khoa học: "An Unsupervised Morpheme-Based HMM for Hebrew Morphological Disambiguation" pdf

Báo cáo khoa học:
... 2000 Hebrew morphological analyzer for Hebrew undotted texts Master’s thesis, Technion, Haifa, Israel (in Hebrew) David Carmel and Yoelle S Maarek 1999 Morphological disambiguation for Hebrew ... frequent tag for a given word in the training corpus – for Hebrew and Arabic, shows some intriguing differences: 92.53% for Arabic and 71.85% for Hebrew Furthermore, as mentioned above, even the use ... based on (Levinger et al., 1995), gives low accuracy of 78.2% This might Morpheme-Based Model for Hebrew 3.1 Morpheme-Based HMM The lexical items of word-based models are the words of the language...
  • 8
  • 104
  • 0

Báo cáo khoa học: "Feature-based Method for Document Alignment in Comparable News Corpora" ppt

Báo cáo khoa học:
... Kasper, and Irina Temnikova 2004 Multilingual and Cross-lingual news topic tracking In Proceedings of the 20th International Conference on Computational Linguistics (COLING) Ralf Steinberger, Bruno ... Bilingual Text Corpora for CrossLanguage Information Integration In Proceedings of the 2005 ACM SIGKDD International Conference on Knowledge Discovery and Data Mining Thuy Vu, Ai Ti Aw and Min ... (10) , Linguistic Independent Unit ( ) Linguistic Independent Unit score (LIU) is defined as the piece of information, which is written in the same way for different languages The following highlight...
  • 9
  • 133
  • 0

Báo cáo khoa học: "Graph Branch Algorithm: An Optimum Tree Search Method for Scored Dependency Graph with Arc Co-occurrence Constraints" potx

Báo cáo khoa học:
... 3: Scored dependency forest 2.5 Semantic Dependency Graph (SDG) The SDG is a semantic-label word DG designed for Japanese sentence analysis The optimum tree search algorithm searches for the optimum ... needed Remove arcj arcj Remove arci arci arcj DGi: Dependency graph for child problem Pi DGj: Dependency graph for child problem Pj Figure 5: Graph branching problem is easier than the parent ... B&B principle, which searches for the optimum well-formed tree in a DF by applying problem expansions called graph branching 3.1 )0 Đ  ă â '  " B  Đ The Optimum Tree Search in DF (1) Partial-problem...
  • 8
  • 133
  • 0

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học:
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanoparticle-based hybridization ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability...
  • 9
  • 153
  • 0

Báo cáo hóa học: " An extragradient-like approximation method for variational inequalities and fixed point problems" ppt

Báo cáo hóa học:
... theorem by an extragradient method for fixed point problems and variational inequality problems Taiwanese J Math 10(5), 1293–1303 (2006) Moudafi, A: Viscosity approximation methods for fixed- points ... version Later on, Ceng and Yao [11] also introduced an extragradient-like approximation method, which is based on the above extragradient method and viscosity approximation method, and proved the strong ... conditions An iterative method for the approximation of fixed points of asymptotically nonexpansive mappings was developed by Schu [12] Iterative methods for the approximation of fixed points of...
  • 18
  • 92
  • 0

Báo cáo hóa học: " Research Article An Extragradient Method for Mixed Equilibrium Problems and Fixed Point Problems" docx

Báo cáo hóa học:
... Zeng and Yao 16 introduced a new hybrid iterative algorithm for mixed equilibrium problems and fixed point problems and Mainge and Moudafi 22 introduced an iterative algorithm for equilibrium problems ... theorem for equilibrium problems and fixed point problems of infinite family of nonexpansive mappings,” Fixed Point Theory and Applications, vol 2007, Article ID 64363, 12 pages, 2007 12 S Plubtieng and ... convergence theorem for an equilibrium problem and a nonexpansive mapping,” in Nonlinear Analysis and Convex Analysis, W Takahashi and T Tanaka, Eds., pp 609–617, Yokohama, Yokohama, Japan, 2007 14 M...
  • 15
  • 121
  • 0

Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx

Báo cáo hóa học:
... measurement Automating the fiber diameter measurement and eliminating the use of the human operator is a natural solution to this problem Image Analysis An image analysis based method was proposed ... established a new method based on image analysis in which the problem associated with the intersections was solved The method uses a binary image as an input Then, the distance transformed image and the ... assessing nanofibers diameters was successfully developed The validity of the method was tested using a simulated image as well as an image of a real electrospun nanofiber web In the case of the real...
  • 4
  • 144
  • 0

Xem thêm

Từ khóa: §6 7 rate based method for packed columns§7 6 rate based method for packed distillation columns3 le an ha 2003 a method for word segmentation in vietnamese orpus linguistics lancaster uk 2003analysis based method for detecting activation signalsa pcr based method for genotyping individual rad markersamp linear prediction coding based method for speech recognition via neural networktrust based security for wireless ad hoc and sensor networks pdfimplementing evidence based practices for juvenile justice prevention and treatment in communitiesmodel based integration for clinical trial simulation and design a phase ii case study for naratriptanan easy to use interface for updating the date and timea multiplex real time pcr platform integrated into automated extraction method for the rapid detection and measurement of oncogenic hpv type specific viral dna load from cervical samplesactivities for teaching about evolution and the nature of sciencebalance integration and harmonization selected metaphors for managing the parts and the whole of livingfas fasd for the us canada and the province of alberta3 d microvascular tissue constructs for exploring concurrent temporal and spatial regulation ofTÀI LIỆU bồi DƯỠNG HSG SINH học 11Giáo án dạy bồi dưỡng ngữ văn 7Ảnh hưởng của văn hóa Phật giáo đối với văn hóa Việt Nam thời Lý - Trần và bảo tồn, phát huy giá trị văn hóa Phật giáo trong giai đoạn hiện nay.Đặc điểm thể chân dung văn học của Hồ Anh TháiGiải quyết tranh chấp trong khuôn khổ Hiệp định các biện pháp đầu tư liên quan đến thương mại (TRIMs)Hoàn thiện chế định về người thực hiện trợ giúp pháp lý ở Việt Nam hiện nayHợp tác phát triển du lịch bền vững tiểu vùng sông Mekong giai đoạn 1990-2020.Nâng cao hiệu quả công tác phục vụ người dùng tin tại Thư viện Trường Đại học Hải DươngNghiên cứu giải pháp tích hợp chữ ký số cho ứng dụng dựa trên công nghệ SharePointNgười lao động trong khu công nghiệp với việc tiếp cận dịch vụ hành chính công của chính quyền địa phương hiện nay (Nghiên cứu trường hợp khu công nghiệp Bắc Thăng Long, huyện Đông Anh, Hà Nội)Phân cụm thô của dữ liệu tuần tựPhát triển đội ngũ cán bộ quản lí trường trung học cơ sở huyện Duy Tiên, tỉnh Hà Nam đáp ứng yêu cầu đổi mới giáo dụcQuản lý hoạt động đánh giá kết quả học tập của sinh viên Trường Cao đẳng Kỹ thuật Công nghiệpQuản lý hoạt động dạy học môn tiếng Anh tại trường Trung cấp Văn hóa Nghệ thuật Nam Định đáp ứng yêu cầu năng lực ngoại ngữQuản lý hoạt động dạy học tại trường THPT Nguyễn Bính huyện Vụ bản tỉnh Nam định trong bối cảnh đổi mới giáo dụcQuản lý học liệu tại thư viện đáp ứng yêu cầu đào tạo trường đại học Điều Dưỡng Nam ĐịnhBáo cáo thực tập nghành quản lý nhà nướcTìm hiểu công tác phát triển, khai thác và chia sẻ nguồn tài nguyên số tại Trung tâm Thông tin - Thư viện Đại học Giao thông Vận tảiTRẮC NGHIỆM GIỚI hạn HAYMột số giải pháp chủ yếu nhằm nâng cao hiệu quả kinh doanh của Công ty TNHH Sao Việt Hải Phòng
Nạp tiền Tải lên
Đăng ký
Đăng nhập