Xây dựng quy trình phát hiện một số vi khuẩn thuộc họ enterobacteriaceae gây bệnh ở người bằng phương pháp PCR đa mồi

Xây dựng quy trình phát hiện một số vi khuẩn thuộc họ enterobacteriaceae gây bệnh người bằng phương pháp PCR đa mồi

Xây dựng quy trình phát hiện một số vi khuẩn thuộc họ enterobacteriaceae gây bệnh ở người bằng phương pháp PCR đa mồi
... sinh gây bệnh, đề xuất đề tài Xây dựng quy trình phát số vi khuẩn thuộc họ Enterobacteriaceae gây bệnh người phương pháp PCR đa mồi với mục tiêu sau: a) Xây dựng quy trình phát số vi khuẩn thuộc ... trị PCR đa mồi phát số vi khuẩn thuộc họ Enterobacteriaceae gây nhiễm khuẩn huyết thực hành Bệnh vi n 108 CHƯƠNG TỔNG QUAN 1.1 Dịch tễ học vi khuẩn thuộc họ Enterobacteriaceae gây bệnh nhiễm khuẩn ... trước thực phản ứng PCR cần thiết Vì khuôn khổ luận văn tiến hành tối ưu hóa tham số nhằm xây dựng quy trình PCR đa mồi phát số vi khuẩn gây bệnh thuộc họ Enterobacteriaceae Quy trình không hướng...
  • 82
  • 143
  • 0

Nghiên cứu xây dựng quy trình phát hiện một số chất độc có khả năng gây nhiễm độc hàng loạt trong các mẫu môi trường trên các thiết bị phân tích tại phòng thí nghiệm

Nghiên cứu xây dựng quy trình phát hiện một số chất độc có khả năng gây nhiễm độc hàng loạt trong các mẫu môi trường trên các thiết bị phân tích tại phòng thí nghiệm
... tâm phân tích thí nghiệm Địa chất Tóm tắt nội dung đề tài Đề tài nghiên cứu xây dựng qui trình phát số chất độc khả gây nhiễm độc hàng loạt mẫu môi trờng thiết bị phân tích phòng thí nghiệm ... nhiễm độc hàng loạt mẫu môi trờng thiết bị phân tích phòng thí nghiệm Mục đích đề tài xây dựng qui trình phân tích số chất độc khả gây nhiễm độc hàng loạt trang, thiết bị phòng thí nghiệm Nhiệm ... xây dựng biện pháp dự phòng xử trí nhiễm độc hàng loạt giai đoạn 2001-2004, tiến hành nghiên cứu đề tài nhánh KC 10.13-03 Nghiên cứu xây dựng qui trình phát số chất độc khả gây nhiễm độc hàng...
  • 147
  • 250
  • 0

Nghiên cứu xây dựng quy trình phát hiện một số chất độc có khả năng gây nhiễm độc hàng loạt trong các mẫu sinh học trên các thiết bị phân tích tại phòng thí nghiệm

Nghiên cứu xây dựng quy trình phát hiện một số chất độc có khả năng gây nhiễm độc hàng loạt trong các mẫu sinh học trên các thiết bị phân tích tại phòng thí nghiệm
... phòng xử trí Các biện pháp cần đợc thực theo quy tắc trình tự định Vì thế, đề tài KC.10.13.04: Nghiên cứu xây dựng quy trình phát chất độc khả gây nhiễm độc hàng loạt mẫu sinh phẩm thiết bị ... khoa học công nghệ Học Viện Quân y Báo cáo tổng kết khoa học kỹ thuật Đề tài nhánh KC.10.13.04 Nghiên cứu xây dựng quy trình phát chất độc khả gây NĐHL mẫu sinh phẩm thiết bị phòng thí nghiệm ... cần u tiên chọn phơng pháp phát chất độc nguy hiểm, độc tính cao gây nhiễm độc nhanh 1.3.1 Phơng pháp lấy mẫu: + Lấy mẫu sinh học Lấy mẫu sinh học phân tích độc chất phải tuân theo bốn nguyên...
  • 127
  • 161
  • 0

nghiên cứu và xây dựng quy trình phát hiện một số đột biến gen gây bệnh β-thalassemia

nghiên cứu và xây dựng quy trình phát hiện một số đột biến gen gây bệnh β-thalassemia
... chẩn đoán đột biến gen β-thalassemia nghiên cứu chưa sử dụng rộng rãi chẩn đoán trước sinh Từ vấn đề nêu cần tiến hành đề tài Nghiên cứu xây dựng quy trình phát số đột biến gen gây bệnh βthalassemia” ... BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ TRƯỜNG ĐẠI HỌC Y HÀ NỘI …… ***…… LÊ THẾ KHƯƠNG NGHIÊN CỨU VÀ XÂY DỰNG QUY TRÌNH PHÁT HIỆN MỘT SỐ ĐỘT BIẾN GEN GÂY BỆNH β-THALASSEMIA KHÓA LUẬN TỐT ... tử giúp cho chẩn đoán đột biến gen gây bệnh dễ dàng xác giúp cho hạn chế trẻ sơ sinh mang gen đột biến Ở nước ta kỹ thuật giúp cho chẩn đoán đột biến gen nghiên cứu đạt số thành tựu định Tuy...
  • 61
  • 269
  • 2

Nghiên cứu xây dựng quy trình phát hiện và định lượng human immonodeficiency virus – 1 trong huyết tương người bằng kỹ thuật realtime pcr

Nghiên cứu xây dựng quy trình phát hiện và định lượng human immonodeficiency virus – 1 trong huyết tương người bằng kỹ thuật realtime pcr
... virus huyết tương người kỹ thuật real-time PCR Mục tiêu nghiên cứu tổng quát đề tài là: Xây dựng quy trình phát định lượng Human Immunodeficiency virus huyết tương người kỹ thuật real-time PCR ... Mục tiêu Nghiên cứu xây dựng quy trình phát định lượng Human Immunodeficiency Virus huyết tương người kỹ thuật real-time PCR Nội dung Công việc dự kiến Công việc thực Thu nhận mẫu huyết tương ... cấp kinh phí cho nghiên cứu đề tài xii PHẦN MỞ ĐẦU Tên đề tài Nghiên cứu xây dựng qui trình phát định lượng Human Immunodeficiency Virus huyết tương người kỹ thuật real-time PCR Chủ nhiệm đề...
  • 71
  • 630
  • 2

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm AH5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm AH5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... dụng kỹ thuật chẩn đoán cúm A/H5N1 Chính vậy, thực Nghiên cứu xây dựng quy trình phát nhanh virus cúm gia cầm A/H5N1 mẫu bệnh phẩm kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction ... đặc hiệu để phát kháng nguyên virus Người ta phát kháng nguyên virus trực tiếp từ mẫu bệnh phẩm số kỹ thuật khác nhau, nhiên kỹ thuật sử dụng phổ biến thời gian xét nghiệm nhanh là: Kỹ thuật miễn ... Ương + Mẫu bệnh phẩm thu thập từ gia cầm vụ dịch cúm: 30 mẫu bệnh phẩm thu thập từ gia cầm bị bệnh vụ dịch Đồng thời phát A/H5N1 mẫu phản ứng RT-PCR tối ưu để đánh giá độ tin cậy phản ứng multiplex...
  • 78
  • 59
  • 0

Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR

Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR
... dân huyện Chính lí mà đề tài Nghiên cứu virus (TMV, CMV) gây bệnh ớt huyện Củ Chi, Tp Hồ Chí Minh kỹ thuật ELISA xây dựng quy trình phát CMV kỹ thuật RT-PCR đƣợc thực nhằm xác định sớm mầm bệnh, ... DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ….  … NGHIÊN CỨU VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG ... bệnh hoa Lili kỹ thuật RT-PCR Qua cho thấy kỹ thuật RT-PCR có độ nhạy cao so với kỹ thuật ELISA việc phát virus gây bệnh 2.5.2 Ở Việt Nam Các nghiên cứu bệnh virus mới, có số nghiên cứu trƣờng Đại...
  • 69
  • 429
  • 2

NGHIÊN CỨU XÂY DỰNG QUY TRÌNH PHÁT HIỆN VÀ XÁC ĐỊNH HÀM LƯỢNG MỘT SỐ CHẤT BỊ CẤM SỬ DỤNG TRONG MỸ PHẨM

NGHIÊN  CỨU  XÂY  DỰNG  QUY TRÌNH PHÁT HIỆN VÀ XÁC ĐỊNH  HÀM LƯỢNG  MỘT  SỐ  CHẤT  BỊ  CẤM SỬ DỤNG TRONG MỸ PHẨM
... chất lượng mỹ phẩm theo Thông tư 06/2011/TT-BYT 1.2 MỘT SỐ HỢP CHẤT CẤM SỬ DỤNG VÀ CẦN KIỂM SOÁT HÀM LƯỢNG NGHIÊN CỨU TRONG ĐỀ TÀI 1.2.1 Một số hợp chất màu bị cấm sử dụng mỹ phẩm 1.2.2 Một số ... BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ Y TẾ TRƯỜNG ĐẠI HỌC DƯỢC HÀ NỘI LÊ THỊ HƯỜNG HOA NGHIÊN CỨU XÂY DỰNG QUY TRÌNH PHÁT HIỆN VÀ XÁC ĐỊNH HÀM LƯỢNG MỘT SỐ CHẤT BỊ CẤM SỬ DỤNG TRONG MỸ PHẨM CHUYÊN NGÀNH: ... thành phần cần ý 1.2 MỘT SỐ HỢP CHẤT BỊ CẤM SỬ DỤNG VÀ CẦN KIỂM SOÁT HÀM LƯỢNG NGHIÊN CỨU TRONG ĐỀ TÀI 1.2.1 Một số hợp chất màu bị cấm sử dụng mỹ phẩm Các hợp chất màu chất có màu trạng thái...
  • 218
  • 491
  • 1

xây dựng quy trình phát hiện tính kích thích miễn dịch của một số chất bằng real time rt-pcr

xây dựng quy trình phát hiện tính kích thích miễn dịch của một số chất bằng real time rt-pcr
... Xây dựng quy trình phát tính kích thích miễn dịch số chất real- time RT-PCR có hai nội dung nghiên cứu chính: - Xây dựng quy trình phát tính kích thích miễn dịch - Áp dụng quy trình với số chất ... trình với số chất thử nghiệm 2.1 Xây dựng quy trình phát tính kích thích miễn dịch Mục tiêu: thiết lập thông số cần thiết cho quy trình phát tính kích thích miễn dịch 2.1.1 Nuôi cấy tế bào - Tế ... chế trình apoptosis cảm ứng D-GalN/TNF-alpha in vitro (Tran & cs, 2002) Đề tài Xây dựng quy trình phát tính kích thích miễn dịch số chất real- time RT-PCR tạo công cụ hữu ích việc phát hợp chất...
  • 38
  • 155
  • 0

xây dựng quy trình phát hiện virus PMWaV-1

xây dựng quy trình phát hiện virus PMWaV-1
... 70 PMWaV-1 Áp dụng quy trình vừa xây dựng, giám định PMWaV-1 90 chồi dứa Cayenne thuộc giống: Thái Lan, Trung Quốc Lâm Đồng Các kết thu được: Ly trích RNA tổng số từ mẫu dứa Xây dựng quy trình ... hoạch, phát bệnh, gây thiệt hại lớn cho người trồng Chính vậy, tiến hành thực đề tài "Xây dựng qui trình phát virus PMWaV-1 gây bệnh đỏ đầu chồi dứa Cayenne phương pháp RT-PCR" nhằm xây dựng phương ... cần thiết để đánh giá xác diện PMWaV-1 Như vậy, kết luận quy trình RT-PCR xây dựng hoàn toàn đủ độ tin cậy việc phát PMWaV-1 Hình 4.5: Sơ đồ phản ứng RT-PCR phát PMWaV-1 51 4.3 Kết kiểm tra sản...
  • 66
  • 210
  • 1

XÂY DỰNG QUY TRÌNH PHÁT HIỆN ĐỘT BIẾN rtA181V/T VÀ rtN236T KHÁNG ADEFOVIR CỦA VIRUS VIÊM GAN B (Hepatitis B Virus) BẰNG KỸ THUẬT REAL-TIME PCR

XÂY DỰNG QUY TRÌNH PHÁT HIỆN ĐỘT BIẾN rtA181V/T VÀ rtN236T KHÁNG ADEFOVIR CỦA VIRUS VIÊM GAN B (Hepatitis B Virus) BẰNG KỸ THUẬT REAL-TIME PCR
... nhân viêm < /b> gan < /b> B mãn Xuất phát < /b> từ nhu cầu thực tiễn, chọn đề tài Xây < /b> dựng < /b> quy < /b> trình < /b> phát < /b> đột < /b> biến < /b> rtA181V/T < /b> rtN236T < /b> kháng < /b> Adefovir < /b> virus < /b> viêm < /b> gan < /b> B (Hepatitis B Virus) kỹ thuật realtime PCR , ... phát < /b> nhanh đột < /b> biến < /b> kháng < /b> thuốc, với giá thành thấp có ý nghĩa công tác theo dõi điều trị b nh viêm < /b> gan < /b> siêu vi B Mục đích đề tài: Xây < /b> dựng < /b> quy < /b> trình < /b> xác định đột < /b> biến < /b> kháng < /b> thuốc Adefovir < /b> HBV ... nhiều nghiên cứu b nh viện sở y tế ứng dụng phương pháp giải trình < /b> tự PCR để phát < /b> đột < /b> biến < /b> kháng < /b> thuốc HBV b nh nhân viêm < /b> gan < /b> B mãn điều trị, có đột < /b> biến < /b> kháng < /b> ADV vị trí rtA181T/V rtN236T < /b> Tuy nhiên,...
  • 99
  • 436
  • 3

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng
... phản ứng PCR cho phép phát 2.7 Quy trình mật E 103 CFU/ml hay 3CFU/ ng phươngPCR PCR E coli phát độ x coli thực phẩm bằ phản ứng pháp Căn vào kết thí nghiệm trên, đề nghò qui trình PCR để phát ... TSB Gây nhiễm E coli mật độ Ủ 370C 24 Phát E coli Phát E coli phương pháp truyền thống phươngpháp PCR Hình Sơ đồ khảo sát giới hạn phát E coli mẫu thực phẩm gây nhiễm theo phương pháp truyền thống ... lây nhiễm dẫn đến biến chứng CÁC PHƯƠNG PHÁP PHÁT HIỆN E COLI TRONG THỰC PHẨM 3.1 Phương pháp nuôi cấy truyền thống [6,10] Phương pháp nuôi cấy truyền thống để phát E coli gồm ba bước: (1) tăng...
  • 67
  • 708
  • 6

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...
  • 11
  • 185
  • 0

Xem thêm

Từ khóa: xây dựng quy trình thực hiện công việcxây dựng tiến trình dạy học một số kiến thức chương động lực học chất điểm dưới sự hỗ trợ của website dạy họckhảo sát quy trình sản xuất của cty dệt may gia định phong phú nhằm đề xuất các phương pháp kiểm tra môi trường lao động và bảo hộ lao độngkiểm tra độ nhạy và độ đặc hiệu của phương pháp pcr đa mồi trong phát hiện salmonella gây bệnh tiêu chảynghiên cứu tình hình bệnh suyễn lợn tại một số cơ sở chăn nuôi thuộc các tỉnh khu vực ðồng bằng sông hồng và xây dựng quy trình phòng trị bệnhquy trình thực hiện một dự án xây dựngxây dựng quy trình công nghệ sản xuất một số chế phẩm sinh học và đánh giá hiệu quả tác dụng của các chế phẩm này đối với việc chăn nuôi lợnxây dựng quy trình theo dõi trị liệu dựa trên nồng độ của một số thuốc có giới hạn trị liệu hẹp ở người việtxác định cơ cấu cây trồng và xây dựng quy trình hướng dẫn kỹ thuật trồng cho một số loài cây chủ yéu phục vụ chương trình 327nghiên cứu xây dựng quy trình quản lý đầu tư ứng dụng công nghệ thông tin tại ngân hàng phát triển việt namtrên góc độ về công nghệ sản xuất người ta cho rằng vận tải là một quá trình thực hiện một số giai đoạn theo một trình tự và nội dung nhất địnhco so ly luan xay dung quy trinh kiem toan ngan sach dia phuongxây dựng quy trìnhnghiên cứu và xây dựng quy trình kiểm toán năng lượng cho tòa nhà thương mạinghiên cứu xây dựng quy trình công nghệ sản xuất tricloixiannuric axithọc toán voi toolkitmathlàm thơ lục bátBÀI 3 các PHƯƠNG PHÁP TÍNH TÍCHđịnh dạng văn bản tiết 1hàm điều kiện ìhoán dụBài Giảng Sàn Giao Dịch Chứng Khoánchuyện cũ trong phủ chúa trịnhcôn sơn cađa dạng của lớp thúdanh từBài Giảng Kiểm Soát Nội BộBài Giảng Bằng Chứng Kiểm ToánBài Giảng Báo Cáo Kiểm ToánBài Giảng Nguyên Lý Và Thực Hành Bảo HiểmIntroduction to Banks and BankingIUH VON CO DINH TAI CTY CHE LONG PHU DH CONG NGHIEP TP HO CHI MINHIUH KIEM SOAT CHI PHI TRONG DN DH CONG NGHIEP TP HO CHI MINHIUH QL TY GIA TAI VN DH CONG NGHIEP TP HO CHI MINHbài 16 định dạng văn bản 1