Nhiễm khuẩn bệnh viện do virút hợp bào hấp trẻ em

Nhiễm khuẩn bệnh viện do virút hợp bào hô hấp ở trẻ em
... nhiễm khuẩn bệnh viện virút hợp bào hấp, trẻ em Chúng tiến hành nghiên cứu: Nhiễm khuẩn bệnh viện virút hợp bào hấp trẻ em nhằm khảo sát đặc điểm nhiễm khuẩn bệnh viện virút hợp bào ... suất nhiễm khuẩn bệnh viện virút hợp bào hấp phòng Cấp cứu Đặc điểm dịch tễ học, lâm sàng, cận lâm sàng nhiễm khuẩn bệnh viện virút hợp bào hấp Đặc điểm virút học virút hợp bào hấp gây nhiễm ... tình hình nhiễm khuẩn bệnh viện virút hợp bào hấp 1.439 trẻ điều trị phòng Cấp cứu, khoa hấp, bệnh viện Nhi đồng 1, nhận thấy: Tần suất trẻ mắc nhiễm khuẩn bệnh viện virút hợp bào hấp: Tần...
  • 28
  • 188
  • 0

khảo sát tình hình điều trị nhiễm khuẩn bệnh viện do vi khuẩn đa kháng bằng colistin phối hợp và một số tác dụng không mong muốn tại khoa hồi sức tích cực bệnh viện bạch mai

khảo sát tình hình điều trị nhiễm khuẩn bệnh viện do vi khuẩn đa kháng bằng colistin phối hợp và một số tác dụng không mong muốn tại khoa hồi sức tích cực bệnh viện bạch mai
... Enzyme vi khuẩn bị thay đổi; Vi khuẩn thay đổi enzyme nhng biến dỡng đợc kháng sinh không tác dụng nên lúc vi khuẩn kháng với kháng sinh * Sự kháng thuốc chéo; Một số vi khuẩn kháng với loại kháng ... tính, nguy kháng kháng sinh, kháng sinh sử dụng trớc [] Kháng sinh điều trị không thích hợp đợc định nghĩa kết xét nghiệm vi khuẩn học cho thấy kháng sinh điều trị thời điểm chẩn đoán NKBV không hiệu ... cao vi khuẩn c trú thể mà không gây bệnh Âm tính giả hay gặp bệnh nhân điều trị kháng sinh trớc đó, không cho phép loại trừ khả nhiễm khuẩn Khởi đầu liệu pháp kháng sinh nên đặt xuất sốt, tăng bạch...
  • 85
  • 903
  • 8

Một số đặc điểm dịch tễ học của nhiễm khuẩn bệnh viện do vi khuẩn kháng carbapenem mang gen NDM-1 tại bệnh viện Việt Đức-Hà Nội, 2010-2011

Một số đặc điểm dịch tễ học của nhiễm khuẩn bệnh viện do vi khuẩn kháng carbapenem mang gen NDM-1 tại bệnh viện Việt Đức-Hà Nội, 2010-2011
... cứu: Một số đặc điểm dịch tễ học nhiễm khuẩn bệnh vi n vi khuẩn kháng carbapenem mang gen NDM-1 bệnh vi n Vi t Đức-Hà Nội, 2010-2011 với mục tiêu cụ thể sau Mô tả số đặc điểm dịch tễ học bệnh ... số đặc điểm dịch tễ học lâm sàng bệnh nhân nhiễm khuẩn bệnh vi n vi khuẩn kháng carbapenem mang gen NDM-1 bệnh vi n Vi t Đức - Hà Nội - Bệnh nhân nhiễm khuẩn bệnh vi n kháng carbapenem mang gen ... nhân nhiễm khuẩn bệnh vi n vi khuẩn kháng carbapenem mang gen NDM-1 phân lập bệnh vi n Vi t ĐứcHà Nội Mô tả tình trạng ô nhiễm vi khuẩn kháng carbapenem mang gen NDM-1 số mẫu môi trường bệnh vi n...
  • 201
  • 312
  • 0

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hấp Việt Nam

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hô hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hô hấp ở Việt Nam
... Nớc Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phơng pháp chẩn đoán sớm, phác đồ điều trị hiệu dự phòng bệnh vi m đờng hấp cấp vi rút H5N1, vi rút cúm A vi rút hợp bào hấp Vi t Nam Đề tài ... biện pháp phòng chống bệnh vi m đờng hấp cấp vi rút cúm H5N1, vi rút cúm A vi rút hợp bào hấp Phần A: Vi m đờng hấp cấp vi rút cúm a v vi rút cúm a/ h5n1 Chơng Tổng quan 1.1 Khái niệm cúm ... PCR (bp) mồi NP_F NP_R 69 ggaattcatggcgtctcaaggcaccaaa 71 tcccccgggtcaattgtcatattcctctgc N1_F GGAATTCATGAATCCAAATCAGAAGATAATAACCATT N1_R TCCCCCGGGCTACTTGTCAATGGTGAAT 1573 Thành phần phản ứng...
  • 272
  • 397
  • 2

Khảo sát tình hình sử dụng kháng sinh điều trị bệnh nhiễm khuẩn hấp trẻ em dưới 5 tuổi tại khoa nhi bệnh viện tỉnh bắc ninh và khoa nhi bệnh viện huyện tiên du năm 2003

Khảo sát tình hình sử dụng kháng sinh điều trị bệnh nhiễm khuẩn hô hấp ở trẻ em dưới 5 tuổi tại khoa nhi bệnh viện tỉnh bắc ninh và khoa nhi bệnh viện huyện tiên du năm 2003
... việc sử dụng kháng sinh điều trị nhi m khuẩn hấp trẻ em đề tài Khảo sát tình hình sử dụng kháng sinh điều trị nhỉễm khuẩn hấp trẻ em tuổi khoa Nhi Bệnh viện tỉnh Bắc Ninh khoa Nhi Bệnh viện ... vào điều trị Tại Bệnh viện Tiên Du bệnh nhi m khuẩn hấp chiếm 57 ,6% số bệnh nhân vào điều trị • Với bệnh nhi m khuẩn hấp trẻ em tuổi, bệnh viêm phổi chiếm tỷ lệ cao bệnh viện Tại Bệnh viện ... (19,0%) Tại Bệnh viện Tiên Du bệnh hấp đứng thứ (18,6%) • Tại khoa Nhi bệnh viện, bệnh nhi m khuẩn hấp chiếm tỷ lệ cao Tại khoa Nhi Bệnh viện Bắc Ninh, bệnh nhi m khuẩn hấp chiếm 60,9% số bệnh...
  • 49
  • 84
  • 0

Tài liệu Nguy cơ nhiễm khuẩn hấp trẻ em trong mùa hè doc

Tài liệu Nguy cơ nhiễm khuẩn hô hấp ở trẻ em trong mùa hè doc
... Phó Chủ nhiệm Khoa hấp bệnh viện cho biết, nhóm bệnh hấp trẻ mắc phải chủ yếu nhiễm khuẩn hấp cấp tính, hen dị ứng trẻ Vào mùa hè, bệnh hen có giảm song bệnh nhiễm khuẩn lên Tỷ lệ mắc ... gia hấp nhi cho biết, nguy bùng phát bệnh viêm đường hấp trẻ em mùa là: Thời tiết nóng ẩm tạo điều kiện cho loại virut, vi khuẩn phát triển, thể non yếu trẻ khiến cho loại virut, vi khuẩn ... thường gặp nhiễm khuẩn hấp trẻ em TS Tuấn cho biết, hầu hết trường hợp nặng tuổi, sau 1-2 ngày trẻ biểu triệu chứng rõ rệt sốt cao lên, ho nhiều hơn, tiếng thở khò khè Trẻ bị khó thở, ho kèm theo...
  • 5
  • 227
  • 1

Nghiên cứu áp dụng máy thở áp lực dương liên tục (CPAP) KSE sản xuất tại việt nam để điều trị suy hấp trẻ em tại một số bệnh viện nhi tuyến tỉnh

Nghiên cứu áp dụng máy thở áp lực dương liên tục (CPAP) KSE sản xuất tại việt nam để điều trị suy hô hấp ở trẻ em tại một số bệnh viện nhi tuyến tỉnh
... TH P LC DNG LIấN TC (CPAP) KSE SN XUT TI VIT NAM IU TR SUY Hễ HP TR EM TI MT S BNH VIN NHI TUYN TNH Ch nhim ti : TS Khu Th Khỏnh Dung C quan (t chc) ch trỡ ti : Bnh vin Nhi trung ng Cp qun ... CễNG NGH TI NGHIấN CU P DNG MY TR TH P LC DNG LIấN TC (CPAP) KSE SN XUT TI VIT NAM IU TR SUY Hễ HP TR EM TI MT S BNH VIN NHI TUYN TNH Ch nhim ti C quan ch trỡ ti (ký tờn) (ký tờn v úng du) ... CPAP -KSE ( ph lc 1) õy l CPAP to ỏp lc bng ct nc (bubble CPAP), tớnh u vit ca to ỏp lc bng ct nc ú l to rung dao ng trờn ng th nh s dng mỏy th cao tn 14 Dạng sóng hấp thở CPAP tạo áp lực...
  • 94
  • 797
  • 4

Nghiên cứu tác hại của hút thuốc lá thụ động đối với bệnh hấp trẻ em dưới 6 tuổi tại tỉnh bắc giang 2007 2008

Nghiên cứu tác hại của hút thuốc lá thụ động đối với bệnh lý hô hấp ở trẻ em dưới 6 tuổi tại tỉnh bắc giang 2007 2008
... TP Bc Giang v huyn Lng Giang (tng ng l 11 ,6% v 5,4%) TP Bc Giang 16 Huyn Lng Giang 14.7 14 11 .6 12 10 6. 5 5.4 Hin hỳt Hin hỳt hng ngy Biu 1: T l hỳt thuc nhng ngi chm súc tr uc iu tra 16 Ti ... 0,54 2,55 1,28 0,87 1, 86 1 0 ,64 0,39 1, 06 0,73 0,55 0 ,64 0,28 0,22 0,24 1,89 1,37 1,73 0,71 0,35 1,45 0, 96 1,57 0,82 0,41 0 ,64 0,39 2,21 3,89 1,70 1.09 0 ,66 1,78 1,08 0,71 1 ,64 19 BN LUN Trong nghiờn ... kinh t - Nghốo - Khụng nghốo Tng Thnh ph Bc Giang n % Huyn Lng Giang n % Tng s a bn n % 283 135 66 58,5 27,9 13 ,6 403 58 59 77,4 11,2 11,4 68 6 193 125 68 ,3 19,2 12,5 73 402 1.9 15 83.1 28 420 72...
  • 29
  • 560
  • 3


... LUẬN sinh trùng co thể ảnh hường lên hệ thống hấp qua hai chế: (1) Tổn thuơng học gây sư diện sinh trùng (2) Do đáp ứng miễn dịch thể sinh trùng hay thành phần sinh trùng[ 4] Biểu đường ... lâm sàng minh họa cho vấn đề nhiễm sinh trùng nội tạng trẻ em Trường hợp Bệnh nhân nam 11tuổi, nhà Quận TP HCM, đến khám bệnh : ho máu Bệnh sử ngày không sốt , sáng ngủ dậy sau đánh thấy ... có hiệu điều trị tổn thương phổi nhiễm sinh trùng kể Cần giáo dục cộng đồng cách lan truyền bệnh, mối nguy hại bệnh , cách phòng tránh nhiễm sinh trùng ...
  • 9
  • 304
  • 0

Kỹ thuật sơ cứu nghẹt thở do dị vật đường hấp trẻ lớn và người lớn

Kỹ thuật sơ cứu nghẹt thở do dị vật đường hô hấp ở trẻ lớn và người lớn
... mô tả 2.6 Lặp lại dị vật đánh bật III Một vài lưu ý - Cố gắng giữ nạn nhân bình tĩnh hít thở từ từ - Nghẹt thở có khả xảy nhanh chóng dị vật đưa vào miệng thức ăn; nghẹt thở phù nề bên miệng ... xe cứu thương tắc nghẽn đường thở không giảm, nghe thấy tiếng thở khò khè thở ồn 1.3 Nếu nạn nhân không trả lời được, kêu to gọi giúp đỡ.[3] Nếu có gần, bảo họ gọi cho dịch vụ cấp cứu y tế (dịch ... tỏ đường thở tắc nghẽn không hoàn toàn Điều quan trọng bạn KHÔNG sử dụng nghiệm pháp vỗ lưng nạn nhân có tắc nghẽn đường thở không hoàn toàn có nguy đẩy dị vật (gây bán tắc đường thở) ngược lên...
  • 22
  • 137
  • 0

Xem thêm

Từ khóa: bệnh nhiễm khuẩn hô hấp ở trẻ embệnh nhiễm khuẩn đường hô hấp ở trẻ emsang kien kinh nghiem phong chong benh nhiem khuan ho hap o tre emông tác phòng chống dịch bệnhnhiễm khuẩn đường hô hấp ở trẻ emnhiễm khuẩn hô hấp ở trẻ embệnh viêm hô hấp ở trẻ emcác bệnh hô hấp ở trẻ embệnh viêm đường hô hấp ở trẻ emphòng bệnh hô hấp ở trẻ embệnh hô hấp ở trẻ emnhiễm trùng đường hô hấp ở trẻ emcác bệnh về đường hô hấp ở trẻ embệnh về đường hô hấp ở trẻ embệnh đường hô hấp ở trẻ emphòng bệnh viêm đường hô hấp ở trẻ emPhát triển thương hiệu CTC Công ty Cổ phần Xây lắp Bưu điện miền TrunPhát triển thương hiệu tại Công ty Cổ phần Sứ CosaniQuan điểm triết học Mác - Lênin về mối quan hệ biện chứng giữa con người và tự nhiên với việc bảo vệ môi trường sinh thái ở Đà Nẵng hiện naQuản trị quan hệ khách hàng tại Công ty Cổ phần Thép Dana-ÝQuản trị rủi ro trong cho vay đối với doanh nghiệp xuất nhập khẩu tại Ngân hàng TMCP Đầu tư và Phát triển Việt Nam - Chi nhánh Bình ĐịnTăng cường huy động tiền gửi tiết kiệm tại Ngân hàng Thương mại Cổ phần Công Thương Việt Nam - Chi nhánh KCN Phú TàiTăng cường kiểm soát chi phí tại Trung tâm Điện toán Truyền số liệu KVIIThế giới nghệ thuật truyện ngắn Hòa VangTính giá thành trên cơ sở hoạt động (ABC) tại Công ty TNHH Việt ÝTình thái trong câu đặc biệt, câu tỉnh lược và câu dưới bậcTính toán công trình chịu tải trọng gió có tiết diện tròn thay đổi theo chiều caoTính toán dầm bê tông cốt thép đặt cốt thép theo các tiêu chuẩn thiết kếTính toán dầm thép chịu cắt theo TCXDVN 338 -2005 và theo quy phạm Hoa Kỳ AISC-200Tính toán hệ dầm sàn liên hợp thép - bê tông nhà nhiều tầng có kể đến tương tác không hoàn toàn giữa bản bê tông và dầm thép hình theo tiêu chuẩn Eurocode 4Tính toán khả năng chịu lực của tiết diện cột liên hợp thép bê tông chịu nén lệch tâm có xét đến ảnh hưởng của lực cắt theo tiêu chuẩn Eurocode 4Ứng dụng mô hình SAAS xây dựng dịch vụ web giải quyết chế độ ngắn hạn tại cơ quan Bảo hiểm xã hội thành phố Đà NẵnVấn đề bề rộng khe nứt ở khớp dẻo của dầm bê tông cốt thépVận dụng bảng cân bằng điểm (Balanced Scorecard) trong đánh giá thành quả hoạt động tại Trường Cao đẳng Kinh tế - Kỹ thuật Quảng NaSKKN ỨNG DỤNG TÍNH ĐƠN ĐIỆU CỦA HÀM SỐ ĐỂ GIẢI PHƯƠNG TRÌNH, HỆ PHƯƠNG TRÌNHBỘ đề đáp án vào 10 các TỈNH 2015 2016
Nạp tiền Tải lên
Đăng ký
Đăng nhập