NGHIÊN cứu TÌNH HÌNH NHIỄM VIRUS VIÊM GAN c (HCV) ở BỆNH NHÂN đến KHÁM và điều TRỊ tại BỆNH VIỆN BỆNH NHIỆT đới TRUNG ƯƠNG từ 62012 đến 62016

Nghiên cứu đặc điểm nhiễm virus viêm gan c (HCV) bệnh nhân chạy thận nhân tạo tại bệnh viện bạch mai

Nghiên cứu đặc điểm nhiễm virus viêm gan c (HCV) ở bệnh nhân chạy thận nhân tạo tại bệnh viện bạch mai
... cho phép hạn chế lây nhiễm HCV Để x c định rõ nhiễm virus viêm gan C nhóm tiến hành nghiên c u đề tài Nghiên c u đ c điểm nhiễm virus viêm gan C (HCV) bệnh nhân chạy thận nhân tạo bệnh viện Bạch ... virus viêm gan C cha nghiên c u thành c ng vaccin viêm gan C nên vi c phòng ngừa viêm gan C cha c hiệu tỷ lệ nhiễm virus viêm gan C cao Theo Seeff L.B [67] cho thấy 80 - 85% ngời nhiễm HCV chuyển ... kỹ thuật nguy lây nhiễm cao với virus viêm gan C (HCV) Tỷ lệ nhiễm virus viêm gan C nhóm bệnh nhân chạy thận nhân tạo chu kỳ tăng theo thời gian chạy thận nhân tạo, theo nghiên c u Nguyễn Đăng...
  • 137
  • 1,032
  • 3

Nghiên cứu tình hình nhiễm virus viêm gan b cán bộ, công chức đến khám sức khỏe tại một số cơ sở y tế thành phố huế năm 2011

Nghiên cứu tình hình nhiễm virus viêm gan b ở cán bộ, công chức đến khám sức khỏe tại một số cơ sở y tế thành phố huế năm 2011
... Nghiên < /b> cứu < /b> tình < /b> hình < /b> nhiễm < /b> virus < /b> viêm < /b> gan < /b> B cán b , cơng chức đến khám sức khỏe số sở y tế thành phố Huế năm 2011 với mục tiêu: Xác định tỷ lệ nhiễm < /b> virus < /b> viêm < /b> gan < /b> B cán b , cơng chức đến khám ... cơng chức đến khám sức khỏe số sở y tế thành phố Huế năm 2011 Tìm hiểu số y u tố liên quan nhiễm < /b> virus < /b> viêm < /b> gan < /b> B cán b , cơng chức đến khám sức khỏe số sở y tế thành phố Huế năm 2011 7 Chương TỔNG ... B GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC HUẾ TRƯỜNG ĐẠI HỌC Y DƯỢC PHẠM THỊ HỒNG MINH NGHIÊN CỨU TÌNH HÌNH NHIỄM VIRUS < /b> VIÊM GAN < /b> B CÁN B , CÔNG CHỨC ĐẾN KHÁM SỨC KHỎE TẠI MỘT SỐ CƠ SỞ Y TẾ THÀNH PHỐ HUẾ...
  • 80
  • 249
  • 2

TÌNH HÌNH NHIỄM VIRUS VIÊM GAN C TRÊN NGƯỜI NGHIỆN CHÍCH MA TÚY ppsx

TÌNH HÌNH NHIỄM VIRUS VIÊM GAN C TRÊN NGƯỜI NGHIỆN CHÍCH MA TÚY ppsx
... lệ nhiễm HCV người nghiện chích ma túy nghiên c u 61,5% Tỷ lệ phù hợp với nghiên c u kh c cho thấy người nghiện chích ma túy c nguy lây nhiễm HCV cao (50-90%) so với nhóm kh c nguy kh c Đồng nhiễm ... đối tượng nghiên c u Đa số người nghiện chích ma túy nhiễm HCV HCV thường gặp người nghiện chích ma túy Tỷ lệ nhiễm HCV người nghiện chích ma túy thay đổi nhiều qu c gia, dao động từ 10–90% (Hungari ... đường tình d c HIV HBV cao HCV, tình d c đồng giới người nghiện chích ma túy nguy cao cho vi c đồng nhiễm, vấn đề đạo đ c tình d c đồng giới châu Á chấp nhận châu Âu C lẽ mà nhà tù nghiên c u c ...
  • 16
  • 186
  • 0

NGHIÊN cứu TÌNH TRẠNG NHIỄM VIRUS VIÊM GAN b PHỤ nữ có THAI tại THÀNH PHỐ THÁI BÌNH KHẢ NĂNG lây TRUYỀN từ mẹ SANG CON

NGHIÊN cứu TÌNH TRẠNG NHIỄM VIRUS VIÊM GAN b ở PHỤ nữ có THAI tại THÀNH PHỐ THÁI BÌNH và KHẢ NĂNG lây TRUYỀN từ mẹ SANG CON
... tuần Theo kết nghiên < /b> cứu < /b> tháng 9/2008 1077 đối tượng Hải Phòng tỷ lệ nhiễm < /b> HBV là: 12,2% Đa số nhiễm < /b> HBV mạn tính, số số lớn tình < /b> trạng < /b> viêm < /b> gan < /b> B mạn tính nhu cầu điều trị b nh Tuy nhiên ... tiêu nghiên < /b> cứu < /b> Đề tài mục tiêu: Nghiên < /b> cứu < /b> tỷ lệ kháng thuốc tự nhiên HBV Hải Phòng ĐốI TƯợNG PHƯƠNG PHáP Đối tượng 113 chủng HBV đối tượng nghiên < /b> cứu < /b> thuộc nhóm: Thuyền viên lao động biển, ... từ 2007 đến 2010 Tất 113 đối tượng nhiễm < /b> HBV chưa dùng thuốc điều trị đặc hiệu virus < /b> viêm < /b> gan < /b> B Phương pháp nghiên < /b> cứu < /b> Tách ADN HBV từ mẫu máu nhiễm < /b> HBV làm phản ứng PCR để tổng hợp đoạn gen Pol-...
  • 3
  • 126
  • 2

HCV - RNA kiểu gen virus viêm gan C (HCV) bệnh nhân chạy thận nhân tạo (TNT) tại bệnh viện Bạch Mai

HCV - RNA và kiểu gen virus viêm gan C (HCV) ở bệnh nhân chạy thận nhân tạo (TNT) tại bệnh viện Bạch Mai
... - 3' Probe HCV1 5' - 56FAM - AGGTAGACGTCAGCCTATCCT - BHQ1 - 3' Probe HCV2 5' - 56FAM - CACGTGGCTGGGATCGCTCCG - BHQ1 - ' Probe HCV6 5' - 56FAM - CAGGCACTGGGCTCAGCACGC - BHQ1 - ' TCNCYH Phil truxyng ... 1.1 Ty le HCV - RNA (+) 70 benh nhan CO anti - HCV( +) Bang Phan bo kieu gen HCV tren 64 benh nhan CO HCV - RNA (+) Bang Ty le HCV - RNA (+) a 70 benh nhan cd anti - HCV (+) Kieu gen HCV 1 vi2 6 ... nhdm nghien cuu c6 tai lugng virus > 10^ copies/ml dugc xic djnh kieu gen HCV Cac ky thuat nghien cupu - HCV - RNA dugc phit hien bing ky thuat Real time RT - PCR djnh lugng HCV - RNA: Su dung...
  • 6
  • 82
  • 0

Nghiên cứu thực trạng nhiễm virus viêm gan B nhận thức của các đối tượng đến xét nghiệm tại Trung tâm y tế dự phòng Hải phòng năm 2008

Nghiên cứu  thực trạng nhiễm virus viêm gan B và nhận thức của các đối tượng đến xét nghiệm tại Trung tâm y tế dự phòng Hải phòng năm 2008
... lệ nhiễm < /b> virus < /b> viêm < /b> gan < /b> B đối tượng nhân dân thành phố Hải Phòng đến xét nghiệm Trung tâm y tế dự phòng Hải Phòng năm 2008 Đánh giá nhận thức, thực < /b> hành phòng chống l y nhiễm < /b> virus < /b> viêm < /b> gan < /b> B đối ... 4: B n luận kết 41 Tình hình nhiễm < /b> virus < /b> viêm < /b> gan < /b> B đối tượng đến xét nghiệm Trung tâm y tế dự phòng Hải phòng năm 2008 .41 Nhận thức, thực < /b> hành phòng chống l y nhiễm < /b> virus < /b> viêm < /b> gan < /b> ... quan với tình hình nhiễm < /b> virus < /b> viêm < /b> gan < /b> B đối tượng đến xét nghiệm Trung tâm y tế dự phòng Hải phòng năm 2008 25 B ng 3.8 Kiến thức đối tượng dấu hiệu b nh viêm < /b> gan < /b> virus < /b> B: 25...
  • 35
  • 508
  • 4

Nghiên cứu thực trạng nhiễm virus viêm gan B nhận thức

Nghiên cứu thực trạng nhiễm virus viêm gan B và nhận thức
... OBO OKS CO M 1.1 Virus < /b> viêm < /b> gan < /b> B: 1.1.1 Vài nét v l ch s b nh virus < /b> viêm < /b> gan < /b> B Vi m gan < /b> virus < /b> m t b nh c đ 5.BC c mơ t l n đ u tiên t th k th N m 1947, MacCallum Bauer phân bi t viêm < /b> gan < /b> A Viêm < /b> ... t b o gan < /b> b nhi m HBV liên quan t i c ch gây ung th 1.1.2.2 Các protein c u trúc c a virus < /b> viêm < /b> gan < /b> B: * Kháng ngun b m t virus < /b> viêm < /b> gan < /b> B (HBsAg): HBsAg kháng ngun b m t c a virus < /b> viêm < /b> gan < /b> B ... m virus < /b> viêm < /b> gan < /b> B cách th c lây truy n có s khác bi t rõ r t gi a vùng khác th gi i Trên c s u tra huy t h c d u n mi n d ch c a virus < /b> viêm < /b> gan < /b> B đ c bi t HBsAg, m c đ nhi m virus < /b> viêm < /b> gan < /b> B...
  • 35
  • 15
  • 0

Nghiên cứu tỷ lệ nhiễm virus viêm gan b mối liên quan giữa nồng độ vius viêm gan b với một số triệu chứng lâm sàng, xét nghiệm bệnh nhângan

Nghiên cứu tỷ lệ nhiễm virus viêm gan b và mối liên quan giữa nồng độ vius viêm gan b với một số triệu chứng lâm sàng, xét nghiệm ở bệnh nhân xơ gan
... Mối liên quan nồng độ virus < /b> viêm < /b> gan < /b> B với số triệu chứng thực thể b nh nhân gan < /b> có HBsAg(+) 46 B ng 3.21 Mối liên quan nồng độ virus < /b> viêm < /b> gan < /b> B với số lượng hồng cầu b nh nhân gan < /b> ... có nghiên < /b> cứu < /b> tỷ < /b> lệ < /b> nhiễm < /b> virus < /b> viêm < /b> gan < /b> B bệnh nhân gan < /b> mối liên quan nồng độ virus < /b> viêm < /b> gan < /b> B với số triệu chứng lâm sàng, xét nghiệm b nh nhân gan < /b> Vì tiến hành nghiên < /b> cứu < /b> đề tài nhằm ... B Y TẾ TRƯỜNG ĐẠI HỌC Y DƯỢC HẢI PHÒNG NGUYỄN VĂN ÁI NGHIÊN CỨU TỶ LỆ NHIỄM VIRUS < /b> VIÊM GAN < /b> B VÀ MỐI LIÊN QUAN GIỮA NỒNG ĐỘ VIRUS < /b> VIÊM GAN < /b> B VỚI MỘT SỐ TRIỆU CHỨNG LÂM SÀNG, XÉT NGHIỆM B NH...
  • 111
  • 83
  • 0

nghiên cứu đặc điểm lâm sàng kết quả điều trị viêm quanh răng bảo tồn người cao tuổi khám điều trị tại bệnh viện đại học y hà nội từ 10/2011 đến 9/2012

nghiên cứu đặc điểm lâm sàng và kết quả điều trị viêm quanh răng bảo tồn ở người cao tuổi khám và điều trị tại bệnh viện đại học y hà nội từ 10/2011 đến 9/2012
... 2 B Y T TRNG I HC Y H NI LNG XUN TUN NGHIÊN CứU ĐặC ĐIểM LÂM SàNG KếT QUả ĐIềU TRị VIÊM QUANH RĂNG BảO TồN NGƯờI CAO TUổI TạI BệNH VIệN TRƯờNG ĐạI HọC Y NộI Chuyờn ngnh: Nha ... cao, nh sõu rng, viờm li, viờm quanh rng, mt rng, t l ny tng dn theo tui Nu sõu rng l nguyờn nhõn hng u g y mt rng ngi tr thỡ nha chu viờm l nguyờn nhõn ch yu g y mt rng ngi cao tui T chc Y ... bnh thy cú m chy ra, rng lung lay nhiu Khỏm thy li viờm mn tớnh, ty quanh rng sõu 4-5mm hoc hn, rng lung lay, li co h c rng, rng di lch Túm li, thi k ny cú y nhng du hiu in hỡnh ca bnh viờm quanh...
  • 93
  • 208
  • 3

NGHIÊN cứu TÌNH HÌNH NHIỄM VI rút VIÊM GAN b BỆNH NHÂN UNG THƯ GAN NGUYÊN PHÁT tại BỆNH VIỆN TRƯỜNG đại học y dược HUẾ

NGHIÊN cứu TÌNH HÌNH NHIỄM VI rút VIÊM GAN b ở BỆNH NHÂN UNG THƯ GAN NGUYÊN PHÁT tại BỆNH VIỆN TRƯỜNG đại học y dược HUẾ
... nhân ung thư gan < /b> nguyên phát điều trị Khoa Ung b ớu, B nh vi< /b> n Trường Đại học Y Dược Huế, có số kết luận sau: Tình < /b> hình < /b> nhiễm < /b> vi < /b> rút < /b> vi< /b> m gan < /b> B bệnh nhân ung thư gan < /b> nguyên phát: - 75% b nh nhân ... nguyên phát: - 75% b nh nhân ung thư gan < /b> nguyên phát có HBsAg (+) Mối liên quan vi< /b> m gan < /b> B ung thư gan < /b> nguyên phát: - B nh nhân mang HBsAg (+) có nguy b ung thư gan < /b> nguyên phát cao gấp 17 lần so với ... “Các chế b nh sinh ung thư , Ung thư học lâm sàng, NXB Yhọc, Hà Nội, tr 10-37 Trần Văn Huy (2002), Nghiên < /b> cứu < /b> vai trò b nh nguyên vi < /b> rút < /b> vi< /b> m gan < /b> B, C số đặc điểm ung thư biểu mô tế b o gan< /b> , Luận...
  • 2
  • 149
  • 2

Nghiên cứu tình trạng đồng nhiễm viêm gan b, viêm gan c người nhiễm HIVAIDS tại bệnh viện bệnh nhiệt đới trung ương

Nghiên cứu tình trạng đồng nhiễm viêm gan b, viêm gan c ở người nhiễm HIVAIDS tại bệnh viện bệnh nhiệt đới trung ương
... hết nghiên c u cho thấy nhiễm HIV t c động tiêu c c tới bệnh viêm gan C[ 51] bệnh viêm gan B, làm tăng nguy tổn thương gan C c nghiên c u ảnh hưởng VGB VGC đến bệnh HIV cho thấy rằng, đồng nhiễm ... đến tình trạng đồng nhiễm vi rút viêm gan B C nhóm người nhiễm HIV Tuy nhiên, c ng trình nghiên c u tình trạng đồng nhiễm VGB VGC người HIV, tiến hành đề tài Nghiên c u tình trạng đồng nhiễm viêm ... viêm gan B, viêm gan C người nhiễm HIV/AIDS Bệnh viện Bệnh nhiệt đới Trung ương với m c tiêu sau : Tìm hiểu tình trạng đồng nhiễm VGB, VGC bệnh nhân HIV Biểu lâm sàng c n lâm sàng đồng nhiễm VGB,...
  • 70
  • 298
  • 4

Nghiên cứu tình hình nhiễm độc hàng loạt trong 10 năm gần đây xây dựng biện pháp kiểm soát, tổ chức cấp cứu nhiễm độc hàng loạt

Nghiên cứu tình hình nhiễm độc hàng loạt trong 10 năm gần đây và xây dựng biện pháp kiểm soát, tổ chức cấp cứu nhiễm độc hàng loạt
... báo nhiễm độc Việt Nam 2.2 Xây dựng phơng án triển khai, biện pháp kiểm soát tổ chức xử trí nhiễm độc hàng loạt Việc xây dựng phơng án triển khai, biện pháp kiểm soát tổ chức xử trí nhiễm độc hàng ... xử trí NĐ hàng loạt thống tổ chức diễn tập thử nghiệm Chơng Phơng pháp nghiên cứu 2.1 Thống kê vụ nhiễm độc hàng loạt Việt Nam Việc thống kê vụ nhiễm độc hàng loạt Việt Nam 10 năm gần (1994 - ... trí nhiễm độc hàng loạt Tổng quan tài liệu 1.1 Tình hình nhiễm độc hàng loạt nớc giới Trên giới xẩy nhiều vụ nhiễm độc hàng loạt (NĐHL) với nguyên nhân khác nhau: - Nhiễm độc hàng loạt chiến...
  • 48
  • 141
  • 0

nghiên cứu một số đặc điểm huyết học bệnh nhân suy thận mạn lọc máu chu kì nhiễm virus viêm gan c

nghiên cứu một số đặc điểm huyết học ở bệnh nhân suy thận mạn lọc máu chu kì nhiễm virus viêm gan c
... nghiờn cu ti hon thnh khúa lun ny mt c ch nghiờm t c C c s liu ca lun c ly trung thc, chớnh x c v kt qu cha c cụng b bi bt k t c gi no C c bi trớch dn u ly t c c ti liu ó c cụng nhn Nu c gỡ ... triu chng lõm sng xut hin b x gan C c bin chng ca x gan c th l x gan c chng, nụn mỏu gión tnh mch thc qun, hi chng gan nóo, suy gim chc nng gan Theo mt nghiờn cu Nht thỡ c khong 81.1% viờm gan ... nm[20],[24,[25] 1.1.6 C c phng thc lõy truyn caHCV Theo c c cụng trỡnh nghiờn cu khoa hc c ng b ó x c nh c mt s phng thc lõy truyn HCV v c c yu t nguy c nhim HCV Trong ú c khong 50% nguy c lõy nhim liờn...
  • 48
  • 278
  • 0

nghiên cứu một số đặc điểm huyết học bệnh nhân suy thận mạn lọc máu chu kì nhiễm virus viêm gan c

nghiên cứu một số đặc điểm huyết học ở bệnh nhân suy thận mạn lọc máu chu kì nhiễm virus viêm gan c
... B GIO DC V O TO B Y T TRNG I HC Y H NI PHM VN TUN NGHIÊN C U MộT Số Đ C ĐIểM HUYếT H C BệNH NHÂN SUY THậN MạN L C MáU CHU Kỳ NHIễM VIRUS VIÊM GAN C CHUYấN NGNH:HUYT HC KHểA LUN TT NGHIP C NHN ... nghiờn cu ti hon thnh khúa lun ny mt c ch nghiờm t c C c s liu ca lun c ly trung thc, chớnh x c v kt qu cha c cụng b bi bt k t c gi no C c bi trớch dn u ly t c c ti liu ó c cụng nhn Nu c gỡ ... triu chng lõm sng xut hin b x gan C c bin chng ca x gan c th l x gan c chng, nụn mỏu gión tnh mch thc qun, hi chng gan nóo, suy gim chc nng gan Theo mt nghiờn cu Nht thỡ c khong 81.1% viờm gan...
  • 48
  • 204
  • 0

tình hình nhiễm sán lá gan fasciola spp. trâu, bò tại tỉnh tuyên quang, nghiên cứu sự phát triển của trứng, ấu trùng sán lá gan ngoại cảnh trong ký chủ trung gian

tình hình nhiễm sán lá gan fasciola spp. ở trâu, bò tại tỉnh tuyên quang, nghiên cứu sự phát triển của trứng, ấu trùng sán lá gan ở ngoại cảnh và trong ký chủ trung gian
... bệnh sán gan lớn trâu, 27 2.3.2.1 Tình hình nhiễm sán gan trâu 27 2.3.2.2 Nghiên cứu ô nhiễm trứng ấu trùng sán gan ngoại cảnh chủ trung gian 27 2.3.2.3 Nghiên cứu ... tuổi trâu, - Tỷ lệ cƣờng độ nhiễm sán gan theo mùa vụ - Tỷ lệ cƣờng độ nhiễm sán gan theo tính biệt trâu, 2.3.2.2 Nghiên cứu ô nhiễm trứng ấu trùng sán gan ngoại cảnh chủ trung gian - Sự ... nghiên cứu đề tài: Tình hình nhiễm sán gan Fasciola spp trâu, tỉnh Tuyên Quang, nghiên cứu phát triển trứng, ấu trùng sán gan ngoại cảnh chủ trung gian Mục đích đề tài Đề tài xác định...
  • 97
  • 281
  • 0

Xem thêm

Từ khóa: nghiên cứu tình hình nhiễm giun tròn đường tiêu hóa của chó nuôi ở hà nội và biện pháp phòng trịnghiên cứu tình hình nhiễm khuẩn hô hấp cấp tính ở trẻ dưới 5 tuổinghiên cứu tình hình nhiễm độc cadimi do tiếp xúc nghề nghiệp để đề xuất bổ sung vào danh mục bệnh nghề nghiệpnghiên cứu tình hình tiêm vắc xin phòng uốn ván ở phụ nữ mang thai phường hương long thành phố huếnghiên cứu tình trạng đồng nhiễm hbv hcv ở người nhiễm hivaids tại bệnh viện bệnh nhiệt đới trung ươngnghiên cứu tình trạng khí máu động mạch o2 co2 ở bệnh nhân xơ gannghiên cứu mô hình công ty me công ty con ở một số nƣớc và bài học kinh nghiệmnghiên cứu một số đặc điểm lâm sàng cận lâm sàng và kết quả điều trị bệnh nhân tả có biến chứng tại bệnh viện bệnh nhiệt đới trung ương 102007 52009về phân bố kiểu gen và kiểu gen phụ của vi rút viêm gan c ở bệnh nhân đến khám và điều trị tại bệnh viện bệnh nhiệt đới trung ươngnghiên cứu tình hình viêm nhiễm đường sinh dục dưới và các yếu tố liên quan ở phụ nữ có chồng tại huyện nam giang tỉnh quảng namnghiên cứu đặc điểm lâm sàng cận lâm sàng và điều trị dự phòng ở phụ nữ mang thai nhiễm virus viêm gan btình hình nhiễm virus gây viêm gan b hbvnhiễm virus viêm gan mãn tínhnhiễm virus viêm gan b mãn tínhnghiên cứu tình hình tiêu thụ sản phẩmMột số biện pháp giúp trẻ 3 đến 4 tuổi học tốt môn tạo hìnhMỘT SỐ BIỆN PHÁP GIÁO DỤC VỆ SINH CÁ NHÂN CHO TRẺ MẪU GIÁO 3 ĐẾN 4 TUỔI Ở TRƯỜNG MẦM NON NGA ĐIỀNMỘT SỐ BIỆN PHÁP NHẰM PHÁT HUY TÍNH TÍCH CỰC TRONG CÁC HOẠT ĐỘNG CỦA TRẺ 3 ĐẾN 4 TUỔIĐỒ THỊ HÀM SỐ TIẾP XÚC VỚI TRỤC HOÀNHBài cây phát sinh giới động vật sinh học 7GIÁO DỤC TÌNH CẢM CHO TRẺ 5 ĐẾN 6 TUỔI Ở TRƯỜNG MẦM NON NGA TIẾN THÔNG QUA LỒNG GHÉP VIỆC “HỌC TẬP VÀ LÀM THEO TẤM GƯƠNG ĐẠO ĐỨC HỒ CHÍ MINH”MỘT SỐ BIỆN PHÁP LỒNG GHÉP, TÍCH HỢP NỘI DUNG GIÁO DỤC DINH DƯỠNG VÀ VỆ SINH AN TOÀN THỰC PHẨM VÀO CÁC HOẠT ĐỘNG TRONG NGÀY CHO TRẺ MẪU GIÁO 5 ĐẾN 6 TUỔI.Bài vùng tây nguyên địa lí 9Chủ ngữ trong câu kể ai là gì LTVC lớp 4 số 7Chủ ngữ trong câu kể ai là gì LTVC lớp 4 số 10Chủ ngữ trong câu kể ai là gì LTVC lớp 4 số 20Chủ ngữ trong câu kể ai là gì LTVC lớp 4 số 21Chủ ngữ trong câu kể ai là gì LTVC lớp 4 số 17Chủ ngữ trong câu kể ai là gì LTVC lớp 4 số 2bài 38 tiết 46 thực hành - viết báo cáo ngắn gọn về kênh đào xuy ê....Bai 27 thuc hanh quan sat thuong bien ok96BÀI 4 các QUỐC GIA cổ đại PHƯƠNG tâycác hình ảnh sưu tầm môn lịch sửThần tốc luyện đề toán học THPT quốc gia 2016– tập 3 (hot)MỘT SỐ BIỆN PHÁP NÂNG CAO CHẤT LƯỢNG TỔ CHỨC HOẠT ĐỘNG LÀM QUEN VỚI CÁC BÀI ĐỒNG DAO CHO TRẺ MẪU GIÁO 4 ĐẾN 5 TUỔI
Đăng ký
Đăng nhập