A panel cointegration approach to estimating substitution elasticities in consumption monica auteri mauro costantini
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt
... understood as relations (job title) or events (acquisitions) 3.3 Statistical training Because we had no existing methods to address financial events or relations, we took this opportunity to develop ... contextual information using text classification methods We also use text classification methods to help users to more quickly focus on an area where interesting transactions exist in an interactive ... categories down to above 3040 for categories appearing less frequently 4.2 Online Learning We have embedded our text classification method into an online learning framework that allows users to select...
- 4
- 404
- 0
A systems-based approach to assessing leadership styles in engineers
... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning approach called ... stated that the objective of text mining is to “determine the underlying information on which the data mining operations are applied” Text Mining Approaches There are three major approaches to...
- 183
- 331
- 0
Báo cáo hóa học: " Research Article A Dual Decomposition Approach to Partial Crosstalk Cancelation in a Multiuser DMT-xDSL Environment" docx
... the average capacity increase for allocating less or equal crosstalk cancellation taps than rs is set to zero, (ii) the average capacity increase for allocating more crosstalk cancellation taps ... the average capacity increases per allocated crosstalk cancellation tap For each of K tones the capacity increase has to be calculated for all N − crosstalk cancellation configurations To be able ... that in each iteration of the algorithm a minimum of and a maximum of N − crosstalk cancellation taps are allocated Because of this varying granularity, the crosstalk cancellation tap constraint...
- 11
- 400
- 0
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx
... ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT ... http://www.biomedcentral.com/1471-2229/9/115 A A genome B genome D genome ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA...
- 14
- 324
- 0
Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx
... acknowledged that cell-cell interactions play a major role in tumorigenesis [18] Better understanding and estimating the nature of these interactions may play a key role for an early detection of cancer ... A, Iwasa Y: Possibility of tissue segregation caused by cell adhesion Journal of Theoretical Biology 2003, 221:459-474 Honda H, Yamanaka H, Eguchi G: Transformation of a polygonal cellular pattern ... denote a (marked) cell configuration as In this study, we present a statistical approach to the estimation of the strength of adhesion between cells under the DAH, based on a continuous stochastic...
- 13
- 326
- 0
Tài liệu A Public Health Approach to Children’s Mental Health - A Conceptual Framework pdf
... where a public health approach to children’s mental health can be envisioned and achieved viii A Public Health Approach to Children’s Mental Health: A Conceptual Framework Foreword In the fall ... mental health problems, treating mental health problems, and reclaiming optimal health while addressing a mental health problem A Public Health Approach to Children’s Mental Health: A Conceptual ... itive mental health and Ensuring Quality, Access, and Sustainability Gathering and Analyzing Data to Drive Decisions Assessing A Conceptual Framework for a Public Health Approach to Children’s Mental...
- 141
- 470
- 0
Tài liệu A Client-Centered Approach to Reproductive Health: A Trainer’s Manual docx
... Tasneem and Tayyaba Gul were also an essential part of the core team during earlier trainings in Sargodha The manual was edited earlier by Mary D’Souza It was later transformed into the shape of a ... encourage those who may have had less advanced training to provide the needed skills to trainees 1.2 The manual s adaptability This Trainer’s Manual was originally developed for use in Pakistan ... as training tools and as useful tools to energize and relax participants They are explained within the module when they are to be used TRAINING MATERIALS AND TOOLS Training materials are a resource...
- 287
- 500
- 0
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc
... the word order in target language To this end, we propose a simple but effective ranking-based approach to word reordering The ranking model is automatically derived from the word aligned ... baseline system for In order to show whether the improved performance is really due to improved reordering, we would like to measure the reorder performance directly 917 Reordering Performance As ... concludes the paper Word Reordering as Syntax Tree Node Ranking Given a source side parse tree Te , the task of word reordering is to transform Te to Te , so that e can match the word order in target...
- 9
- 615
- 0
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx
... into Bayesian methods for other natural language learning tasks References M Banko and R Moore 2004 A study of unsupervised partof-speech tagging In Proceedings of COLING ’04 E Brill 1995 Unsupervised ... values of the latent variables are then taken to ˆ be those that maximize P (t|w, θ) In contrast, the Bayesian approach we advocate in this paper seeks to identify a distribution over latent variables ... intuitively sensible prediction results from the fact that the Bayesian approach is sensitive to the robustness of a choice of t to the value of θ, as illustrated in Figure Even though a sequence...
- 8
- 523
- 0
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx
... fsm feature, which indicates the state of a simple finite-state automaton that only has two states The automaton is set to initial state (q0) at the top of a message It makes a transition to state ... history for sequential learning in terms of previous messages Thus, for all three dimensions, we report results for histories defined within a single message in our evaluation below Feature Based ... the corpus We also included a feature that indicated the number of words in the segment Thread Structure Features The simplest contextoriented feature we can add based on the threaded structure...
- 4
- 518
- 0
A logic-programming approach to network security analysis potx
... various information and tools together, yielding an end -to- end automatic system Attack graphs One purpose of network security analysis is to generate an attackgraph Roughly speaking, an attack ... suitable for network attack analysis Datalog is popular in deductive databases, and several decades of work in developing reasoning engines for databases has yielded tools that can evaluate Datalog efficiently ... specification is also a program that can be loaded into a standard Prolog environment and executed Datalog has a clear declarative semantics and it is a monotone logic, making it especially suitable...
- 130
- 404
- 0
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
... server translates the information returned by the Sentinels into CycL and adds it to the KB This approach is potentially vulnerable to an attack on the Sentinels themselves, or to spoofing of their ... 95/98/NT/2000/XP, Linux RedHat and Solaris The Attack Planner enables the user to state plan goals, launch the planner and view the attack plans generated For example, a user can state the goal “An external ... that gathers information about the software, hardware and status of the machine it is running on The server polls the Sentinels, gathers network information from them, and then represents that...
- 6
- 490
- 0
New directions Consumer goods companies hone a cross-channel approach to consumer marketing ppt
... new channels such as social media and mobile into the marketing mix to attract and engage consumers However, they are not ready to abandon traditional approaches to consumer marketing CG marketers ... New directions Consumer goods companies hone a cross-channel approach to consumer marketing Executive summary C onsumer goods (CG) manufacturers are aggressively exploring ways to integrate new ... Limited 2012 New directions Consumer goods companies hone a cross-channel approach to consumer marketing Nurturing engagement, loyalty and sales across multiple channels CG manufacturers have discovered...
- 22
- 408
- 0
Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx
... learned sub-word models to guide its hypotheses on phone boundaries Bayesian Model for Segmentation Our model is inspired by previous applications of nonparametric Bayesian models to segmentation ... used to represent 41 acoustic units Instead of discovering repetitive patterns first, our model is able to learn from any given data Unsupervised Speech Segmentation One goal of our model is to ... Segmentation: To find the phonetic boundaries within each utterance • Nonparametric clustering: To find a proper set of clusters and group acoustically similar segments into the same cluster • Sub-word modeling:...
- 10
- 477
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam