THE ROLE OF EMOTION ON ENVIRONMENTAL CHANGES
THE ROLE OF EMOTION ON ENVIRONMENTAL CHANGES
... relationship to the development of pro -environmental behavior 1.6 Scope and Limitation of the Research The scope of this research is the role of emotion and human behavior on environmental changes ... by their emotion 4.4 Environmental Concern Now that the result of emotion and environmental tests made both significant and non-significant role in the study, the participants’ environmental concern ... regarding environmental attitude, the video manipulation test is conducted In the study, it tests the changes in emotion of the participants prior to the awareness of the drastic impacts of environmental...
- 68
- 202
- 0
Báo cáo khoa học: Mutagenic probes of the role of Ser209 on the cavity shaping loop of human monoamine oxidase A docx
... Journal compilation ª 2009 FEBS J Wang et al Ser209 and the structure of human MAO A Table Comparison of steady-state kinetic constants for human MAO A Ser209Ala and Ser209Glu mutants catalyzed ... structures of rat MAO A and human MAO B Proc Natl Acad Sci USA 102, 12684–12689 17 Son SY, Ma A, Kondou Y, Yoshimura M, Yamashita E & Tsukihara T (2008) Structure of human monoamine oxidase A at 2.2-angstrom ... of human MAO A Ser209Ala mutant (—, ) and MAO A Ser209Glu mutant (- - -, s) for the oxidation of para-substituted benzylamine analogs (r) F1,6 values for the human MAO A Ser209Ala and Ser209Glu...
- 13
- 213
- 0
Molecular insights into the role of arginine on protein stabilization
... that, unlike in the case of other additives, the sign of ΓXP of arginine depends on the arginine concentration and on the protein For example, arginine s preferential interactions with Bovine ... stabilizes the two proteins regardless of the arginine concentration, despite the difference in the (concentration-dependent) preferential interactions mentioned above The abovementioned anomaly on the ... experiments on heat-induced aggregation of three proteins in the presence of arginine and guanidine and discusses the role of guanidinium group of arginine on arginine- induced protein stabilization In...
- 167
- 243
- 0
The role of cosmopolitanism on perceptions of authenticity of perfumes and consumer behaviour an investigation in saudi arabia
... survey of 400 consumers in Saudi Arabia was administered to explore how consumer cosmopolitanism and Saudi Arabian consumers’ perceptions of authenticity of both Western and Saudi perfumes influence ... G 2011, The effect of cosmopolitanism on perceptions of authenticity: an investigation in the Saudi Arabian perfume industry Australian and New Zealand Marketing Academy Conference (ANZMAC) Doctoral ... case of both Western and Saudi perfumes; - test for the relationship between consumer perceptions of the authenticity of both Western and Saudi perfumes and resulting behavioural intentions; and...
- 190
- 1,151
- 0
Tài liệu Male Reproductive Health Disorders and the Potential Role of Exposure to Environmental Chemicals pdf
... exposure Male Reproductive Health Disorders and the Potential Role of Environmental Chemical Exposures Overview of prevalence and trends in male reproductive health disorders The reproductive disorders ... 2008, 2009) and by binding to and blocking the AR (Wilson et al 2008), and these will also induce some of the TDS disorders Male Reproductive Health Disorders and the Potential Role of Environmental ... holding father’s nose; Sperm and egg; Baby’s face; Father and son at sunset [Andrew Penner]; all courtesy of [©iStockphoto.com] Male Reproductive Health Disorders and the Potential Role of Environmental...
- 56
- 500
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG vaccine for the control of TB (2 ) Based on available information concerning the effectiveness ... vaccination in the prevention and control of TB in the United States CDC, the Advisory Council for the Elimination of Tuberculosis (ACET), and the Advisory Committee on Immunization Practices (ACIP),...
- 27
- 1,309
- 3
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
- 15
- 635
- 0
Tài liệu Investigating the Role of Poultry in Livelihoods and the Impact of Avian Flu on Livelihoods Outcomes in Africa docx
... 2008; Aning, Turkson, and Asuming-Brempong 2008; Obi, Oparinde, and Maina 2008; Omiti and Okuthe 2008) Therefore, information regarding the role of poultry in the livelihoods of small-scale poultryproducing ... Birol, and D Roy 2010 Investigating the role of poultry in livelihoods and the livelihoods impact of HPAI in Nigeria DFID-funded project for Controlling Avian Flu and Protecting People’s Livelihoods ... No information is available on the costs of culling, diagnostic testing of samples, cleaning and disinfection, and other administrative costs (Obi, Oparinde, and Maina 2008) Regarding the impacts...
- 40
- 759
- 0
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx
... processing approach to comprehension of French, w i l l form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension ... at any moment of the process are context dependent; they depend on the "current state" of the system The system presents an i n i t i a l attempt to integrate AI and brain theory, BT, on two levels, ... recognition comprehension and automatic translation into French One issue, how to chunk French into a phonetic representation of words, along with the implications of the determined representation...
- 5
- 609
- 0
Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx
... group of Glu207 into phytoene (the main labeled component of the lipidsoluble fraction) is systematically diminished by the addition of increasing amounts of [1-3H ]2C-methyl-D -erythritol 4-phosphate ... Formation of 4-(cytidine 50 -diphospho)-2-C-methyl-D -erythritol from 2-C-methyl-D -erythritol 4-phosphate by 2-C-methyl-D -erythritol 4-phosphate cytidyltransferase, a new enzyme in the nonmevalonate ... H (2000) Studies on the nonmevalonate pathway: formation of 2-C-methyl-D -erythritol 2,4-cyclodiphosphate from 2-phospho4-(cytidine 50 -diphospho)-2-C-methyl-D -erythritol Tetrahedron Lett 41,...
- 9
- 572
- 0
NOTES ON THE ROLE OF EDUCATION IN PRODUCTION FUNCTIONS AND GROWTH ACCOUNTING pot
... functions and in growth analysis Some brief remarks on the income -education- ability interrelation conclude the comment I THE ROLE OF EDUCATION IN AGGREGATE PRODUCTION FUNCTIONS AND IN GROWTH ... through the latter parts of this paper as the discussion turns to the implications of the ability -education- income inter- relationships for the assessment of the contribution of education to growth, ... review and comparison of the Denison and Schultz approaches EDUCATION IN PRODUCTION FUNCTIONS AND GROWTH ACCOUNTING 73 to distinguish classes of items, even within the same commodity class, if they...
- 59
- 595
- 0
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf
... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP and D2R3–YFP – genetic variant of dopamine D2 receptor) ... of dopamine D2 receptor) e Measured in cell co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R3–YFP – genetic variant of dopamine D2 receptor) f Measured in cell co-expressing dopamine...
- 16
- 567
- 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... to attract the attention of patients and families and to stimulate them to attend to the information 3.2 Do pictures draw attention to health education materials? We located one study in health ... asked if they had read the instructions (attention) If they had, they were asked a series of questions about information in the handout (recall) and also about what they had done to care for their ... creating and evaluating printed materials We also draw on recommendations by Dowse and Ehlers [45] and by Rohret and Ferguson [46] in their earlier reviews of the role of pictures in health education...
- 18
- 919
- 0
REPORT of the CAS WORKING GROUP on ENVIRONMENTAL POLLUTION and ATMOSPHERIC CHEMISTRY docx
... 1073) 144 Report of the Seventh Session of the EC Panel of Experts /CAS Working Group on Environmental Pollution and Atmospheric Chemistry and the GAW 2001 Workshop (Geneva, Switzerland, to April ... 40 Report of the Fourth Session of the CAS Working Group on Atmospheric Chemistry and Air Pollution, Helsinki, Finland, 18-22 November 1985 January 1987 41 Global Atmospheric Background Monitoring ... Dioxide Concentrations as measured at BAPMoN sites for the year 1988 (WMO TD No 355) 63 Report of the Informal Session of the Executive Council Panel of Experts /CAS Working Group on Environmental Pollution...
- 28
- 435
- 0
Từ khóa: the role of emotionthe role of time in environmental samplingthe role of statistics in environmental scienceon the role of context and prosodythe role of language in the development of emotion regulationon the role of emotional intelligence in second language learningcomment on the role of chinese language in international communicationthe role of language in a science of emotionaristotles ideas on the role of music in educationdescription on the role of technology in enabling communication at the workplacewhat is the role of environmental management systemstudy on the role of the private sector in achieving canadas international development interestsstudy on the role of the private sector in achieving canadau2019s international development intereststrade in higher education the role of the general agreement on trade in services gatsaristotles ideas on the role of music in educationNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM