0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Paleonymy of the human

 Báo cáo y học:

Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"

... reported that 5% of the cases of oral squamous cell carcinoma show diminished expression of hMSH2 protein In the present study, we demonstrated decreased expression of hMSH2 protein in reticular ... OLP subtypes Figure Positive labelling for hMSH2 protein in basal and intermediate epithelial layers of reticular subtype of oral lichen planus patient (streptavidin-biotin amplified system, x ... mounted in PermountTM Negative controls consisted of omission of the primary or the secondary antibody or primary incubation in the presence of non-immunized rabbit serum instead of the primary antibody...
  • 6
  • 461
  • 0
Contrastive analysis on english and vietnames proverbs referring to parts of the human body

Contrastive analysis on english and vietnames proverbs referring to parts of the human body

... in proverbs referring to parts of the human body 3.4 Personification in proverbs referring to parts of the human body Table The meanings of English proverbs referring to parts of the human body ... to parts of the human body Chapter A contrastive analysis on English and Vietnamese proverbs referring to parts of the human body Chapter The meanings of English proverbs referring to parts of ... English and Vietnamese proverbs referring to parts of the human body Contrastive analysis Graduation thesis - A contrastive analysis on English and Vietnamese proverbs referring to parts of the human...
  • 68
  • 1,136
  • 7
The transference of meaning through class of words denoting parts of the human body in english and vietnames

The transference of meaning through class of words denoting parts of the human body in english and vietnames

... of class of words denoting parts of human body in English and VietNamese on semantic transference 2.1 The origin of names referring to parts of the human body According to the aspect of origin, ... features - The amount of meanings In English, there are 82 words having primary meaning referring to parts of the human body possessing the transference of meaning The number of words having two ... of meaning of words denoting parts of the human body in English 1) Abdomen 1 .The part of the body, below the chest, containing the stomach, bowels The back part of an insect 2) Arm Either of the...
  • 69
  • 794
  • 4
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

... HsRad51 to examine whether these loops are actually involved in DNA binding Because aromatic residues are involved in the ssDNA binding by bacterial single stranded DNA- binding protein (SSB) and ... mutagenesis across the HsRad51 -L1 loop, and tested the interaction between the L1 loop and DNA A D B E Involvement of the L1 loop-Tyr232 residue in DNA binding The L1 loop of HsRad51 contains an aromatic ... the direct involvement of the Phe279 residue within the HsRad51 -L2 loop in DNA binding is less evident, because the F279A mutation in the L2 loop did not reduce the DNA- binding ability of HsRad51...
  • 12
  • 662
  • 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... from the human KLK11 gene We determined the nucleotide sequences of 15 clones of the PCR products from the human prostate by oligo cap RACE in order to determine the transcrip- Multiple promoters ... type of KLK11, isoform 2, despite the presence of exon 1c The secretory pathways of KLK11 isoforms appeared to differ, although both isoforms were secreted from cells Hence, the promoter use of the ... and Multiple promoters of the human KLK11 gene 5¢-CCAGGCCTCTAGAATTCTGCAGTT-3¢ The synthesized primer sequence contained a codon for the Ser instead of the Met Both PCR fragments were fused at the...
  • 9
  • 544
  • 0
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... compares the studied network with randomized versions of it with the same size and degree distribution The so-called Z-score quantifies the difference between the studied network and an ensemble of randomized ... functions, and topological features retain functionality and phylogeny However, the nature of the connections between these factors needs to be understood at the level of the protein domain The global ... is observed both if the nodes are removed at random or in order of increasing degree in random webs [61] where ji and ki are the degrees of the nodes located at the ends of the i-th link, with...
  • 12
  • 511
  • 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 509
  • 0
Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

... siRNA selection [43] The first siRNAZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3 ) matched bases 192–210; the second siRNAZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and 5¢-GAGUUUCUCAUGCUUCCU ... human (GCC)n-binding protein Fig Identification of p56 polypeptide as Kruppel-like transcription factor ZF5 by MALDI-TOF assay (A) Fragment of MALDI-TOF spectrum of ¨ p56- derived peptides (B) Mascot ... FMR1 gene These data clearly support the assertion that endogenous ZF5 acts as a transcriptional repressor of the human FMR1 gene Given that FMR1 inactivation in FMR patients has been attributed...
  • 15
  • 472
  • 0
Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

... against MUC5AC, with epitopes located in the MUC5AC C-terminal cysteine-rich part Further localization of the epitopes of 45M1, 2-12 M1 and 166M1 In order to further locate the epitopes of the hitherto ... in the N-terminal region of the C-terminal cysteine-rich part of MUC5AC, presumably in the last CysD domain of the mucin The epitope of 2-12M1 is located in the sequence corresponding to the ... Mapping of the 45M1, 166M1 and 2-12M1 epitopes on the C-terminal cysteine-rich part of human MUC5AC The upper part of the figure shows a schematic representation of full-length human MUC5AC with...
  • 9
  • 330
  • 0
Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

... binding to Ppp4c Subunit type S cerevisiae Drosophila Human Catalytic subunit Core regulatory subunit of Pph3 ⁄ Ppp4c Regulatory subunit of Pph3 ⁄ Ppp4c Core regulatory subunit of Ppp4c Catalytic subunit ... BY4 743 pph3D::kanMX4 ⁄ pph3D::kanMX4 BY4 743 psy4D::kanMX4 ⁄ psy4D::kanMX4 BY4 743 psy2D::kanMX4 ⁄ psy2D::kanMX4 BY4 743 TUB2 ⁄ tub2D::HIS3MX BY4 743 TUB2 ⁄ tub2D::HIS3MX, psy4D::kanMX4 ⁄ psy4D::kanMX4 Fernandez-Sarabia ... YBL 046 w ⁄ Psy4p would appear to be an obligatory core subunit of Pph3p required for the binding of Psy2p, we examined the sensitivity of the YBL 046 w ⁄ Psy4p deletion strain to cisplatin The comparable...
  • 13
  • 389
  • 0
Báo cáo khoa học: Adenine nucleotides inhibit proliferation of the human lung adenocarcinoma cell line LXF-289 by activation of nuclear factor jB1 and mitogen-activated protein kinase pathways doc

Báo cáo khoa học: Adenine nucleotides inhibit proliferation of the human lung adenocarcinoma cell line LXF-289 by activation of nuclear factor jB1 and mitogen-activated protein kinase pathways doc

... Attenuation of LXF-289 cell proliferation by ATP is mediated by the activation of the MEK ⁄ ERK1 ⁄ 2, PI3K and p38 MAPK pathways Activation and translocation of the transcription factors NF -jB1 (p50) and ... Table Inhibition of proliferation of LXF-289 lung tumor cells Effects of signaling pathway inhibitors on ATP-inhibited proliferation (A) and of basal proliferation (B) of LXF-289 lung tumor cells ... and ADP in the inhibition of LXF-289 cell proliferation Cell cycle analysis revealed that inhibition of proliferation of LXF-289 cells by ATP and ADP was mediated by retardation of cell cycle...
  • 12
  • 403
  • 0
Báo cáo khoa học: The protein shuffle Sequential interactions among components of the human nucleotide excision repair pathway pdf

Báo cáo khoa học: The protein shuffle Sequential interactions among components of the human nucleotide excision repair pathway pdf

... ligation of a stretch of DNA to repair the gap created by the excision In TCR, stalled RNA polymerase II acts as a marker for recognition of the lesion by the DNA repair machinery With respect to the ... XPG The results of intricate studies designed to characterize these interactions are reviewed below Fig Scheme of the global genomic repair (GGR) pathway The sequential arrivals and departures of ... sites Taken together, these findings suggest that the structural properties of DNA-damaged substrates, whether intrinsic or the result of protein binding, function in the recruitment of the XPC–hHR23B...
  • 9
  • 474
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...
  • 8
  • 426
  • 0
Báo cáo khoa học: The stop transfer sequence of the human UDPglucuronosyltransferase 1A determines localization to the endoplasmic reticulum by both static retention and retrieval mechanisms docx

Báo cáo khoa học: The stop transfer sequence of the human UDPglucuronosyltransferase 1A determines localization to the endoplasmic reticulum by both static retention and retrieval mechanisms docx

... retained in the ER This result 1067 Retention of human UGT1A in endoplasmic reticulum ´ L Barre et al A B Fig The length of the TMD of UGT1A stop transfer sequence determines the subcellular localization ... disruption of the dilysine motif KSKTH of UGT1A by mutation of lysine to serine residues or by extending the length of the cytoplasmic tail to relocate the dilysine from the critical positions )3 and ... conferred by the UGT1A stop transfer sequence involves at least two determinants, the TMD probably acting by static ER retention and the KSKTH for retrieval of escaped proteins from the post-ER...
  • 9
  • 542
  • 0

Xem thêm

Từ khóa: the circuitry of the human spinal cordand increased knowledge of the human understanding of how the operation of the physical world surroundings through controlled methodsreport of the human rights councilanatomy of the human heart pdfanatomy of the human heart gameanatomy of the human heart pptgross anatomy of the human heart worksheet answersorganization of the human body lab reportgross anatomy of the human heart quizletanatomy and physiology of the human heart pdfthe circuitry of the human spinal cord its role in motor controlthe circuitry of the human spinal cord pdfannual report of the human rights councilreport of the human rights council on its twentieth sessionreport of the human rights council on its 27th sessionNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ