Development of suntool prototype for sunlight shadow study in architecture immersive visualization
Development of suntool prototype for sunlight shadow study in architecture immersive visualization
... use it for sunlight study in modelling software during the conceptual design process Figure 2-8: OKINO Sunlight Study Plug -In System - Time GUI (www.okino.com) Figure 2-9: OKINO Sunlight Study ... DEVELOPMENT OF SUNTOOL PROTOTYPE FOR SUNLIGHT/ SHADOW STUDY IN ARCHITECTURE IMMERSIVE VISUALIZATION ANGGORO, RONI ( B.Arch., Petra Christian University) A THESIS SUBMITTED FOR THE DEGREE OF ... with 3D forms (massing) since the conceptual design phase Since BIM modelling softwares are mostly for architecture design, sunlight and shadow studies often are already integrated in the software...
- 218
- 751
- 0
DEVELOPMENT OF STUDENTS’ ENGLISH FOR SPECIAL PURPOSES COMPETENCE IN TOURISM STUDIES AT TERTIARY LEVEL potx
... determine students’ ESP Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia 13 competence ... stage of the research to create the model for the development of students’ ESP competence Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta ... result forming new experiences Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia...
- 32
- 470
- 0
Development of an approach for interface pressure measurement and analysis for study of sitting
... and 15% of the mean, whereas for 33 Development of an approach for interface pressure measurement and analysis for study of sitting the CONFORMat, the standard deviation was around 3% and 7% In ... work and puts forth recommendations and future work Development of an approach for interface pressure measurement and analysis for study of sitting CHAPTER Literature review 2.1 Applications of interface ... be highly predictable 22 Development of an approach for interface pressure measurement and analysis for study of sitting For measurement of pressure between the body and the supporting materials,...
- 117
- 553
- 0
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the system in a local area Second, the DMC controller is a model-based controller ... controlling the temperature in a room deploying a displacement ventilation HVAC system without heater It is a nonlinear system with large disturbance, which has delay in the control variable and in the...
- 12
- 556
- 0
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... out of the earth 'And wine that maketh glad the heart of man The Development of the Feeling for Nature in the Middle Ages and Modern Times 'The trees of the Lord are full of sap; the cedars of ... life, of mind, mood, and feeling, The Development of the Feeling for Nature in the Middle Ages and Modern Times which we have given it.' And Ebers, 'Lay down your best of heart and mind before ... The Development of the Feeling for Nature in the Middle Ages and Modern Times chief phases of landscape, painting, and garden craft, I have aimed at giving completeness to the historical...
- 194
- 633
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢);...
- 14
- 473
- 0
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefore we can reduce the overhead ... those The presence of all the relevant terms should guarantee that the information in the text is never lost; inserting just the relevant terms allows to limit the development effort, and should...
- 4
- 436
- 0
Báo cáo khoa học: "Demonstration of a prototype for a Conversational Companion for reminiscing about images" doc
... interfaces for the Dialogue Action Forms (DAF) to use It has an easyto-use high-level interface for general DAF designers to code associated tests and actions as well as a low level interface for advanced ... ability of the system to handle more than one kind of application at a time, and news has, of course, an unconstrained vocabulary The following is a fairly typical example of its current capacity, ... are siblings) and that it can access real-time information about places to show that it has some knowledge of what is being talked about, in this case the beaches on Zanzibar, and how this is...
- 6
- 271
- 0
the development of ethics a historical and critical study volume ii from suarez to rousseau sep 2008
... of Natural Law Our Knowledge of Natural Law Application of the Precepts Divine Dispensations from the Natural Law? The Natural Law and the Law of Nations Natural Law and the Basis of Political ... broad use of ‘measure’ and ‘rule’, and asserts that Aquinas would not speak of a law in all these cases (ii 5.6, citing Aquinas, ST 2–2 q141 a6 and ad1) Both as a foundation and as a measure, rational ... essential to natural law He believes that Aquinas agrees with him, against Vasquez, in separating a law (lex) from a standard (regula) and a measure (mensura) When Aquinas refers to our capacity to...
- 935
- 347
- 1
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... evaluate the therapeutic potential of expression vectors carrying the "A" fragment of the diphtheria toxin (DT -A) gene under the control of the H19 regulatory sequences in an ovarian carcinoma ... expression profiling allows an individualized DNA-base approach to cancer therapy The therapeutic potential of the DTA -H19 vector was tested in a rat animal tumor model for colorectal liver metastases ... effective antitumor agents Various gene therapy strategies for the treatment of ovarian cancer are currently under development and aim towards maximal treatment efficacy and minimal adverse effects...
- 11
- 559
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... an approach for targeted therapy of bladder carcinoma by driving the DTA expression under the control of IGF2-P4 and H19 regulatory sequences To evaluate the possible use of IGF2-P4 and H19 regulatory ... therapy is an attractive approach Based on early studies of our group and others, the transcriptional regulatory sequences of the H19 and IGF2 genes emerged as candidates for cancer targeted therapy ... area of the malignant tissue of each bladder was determined by ImagePro Plus software Another healthy mice were used as control The total tumor area of each bladder was determined and the mean...
- 18
- 746
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to...
- 13
- 456
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to...
- 13
- 431
- 0
Collaboration for Agriculture & Rural Development:Sustainable and profitable development of acacia plantations for sawlog production in Vietnam - Milestone 12 " pdf
... phân bón) singling young acacia plantations to produce single-stemmed 12 11 - - - - - - - trees, 3-6 months after planting (tỉa bỏ để lại thân sau – tháng trồng) form-pruning young acacia plantations ... khác?) 7 - nursery management and seedling production (quản lý vườn ươm thu hái hạt) - - - - - - - plantation establishment (site selection and preparation, initial plantation spacing, choice of fertilizer ... management of germplasm and silviculture techniques for sustainable sawlog production and application and interpretation of acacia sawlog financial models Fourteen young scientific staff from FSIV and...
- 7
- 363
- 0
Từ khóa: development of international standards for the b isdn in the usprospects for the development of animal models for the study of bipolar disorderdevelopment of emission inventories for egusdevelopment of emission inventories for non egu point sourcesdevelopment of emission inventories for onroad mobile sourcesdevelopment of emission inventories for other nonroad mobile sourcesdevelopment of q sars for dermal irritation and corrosion assessment using european union new chemicals notification data13 chromium steel the development of the components for a wet gas piping systemdevelopment of a framework for developmental immunotoxicity dit testingdevelopment of alternative models for abnormal behaviorimplication of hybrid states for migration and survival in development adevelopment of counselling criteria for prenatal counselling in cases of anticipated disability of the childanimal models for research and development of insect repellents for human useregulatory issues and challenges associated with the development of performance specifications for modified release parenteral products 14inherent challenges in development of mucosal vaccines for biodefenseNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ