Development of a novel method in electroless copper plating
Development of a novel method in electroless copper plating
... which are generally anions, such as cynide, are added to increase the plating rate to an acceptable level without causing plating bath instability The plating rate of common electroless plating bath ... ethylenediaminetraacetic acid (EDTA), malic acid (Mal), succinic acid (Suc), tartrate (Tart), citrate (Cit), triethanolamine (TEA) and ethylenediamine (En) (Mallory and Haju, 1990), (Shacham-Diamand ... et al., 1992) Electroless plating offers many advantages over electroplating, but it is not without its drawbacks Table 1.1 shows some of the advantages and disadvantages of electroless plating...
- 140
- 275
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not shown) These results indicate that the ... or in the presence of EDTA, which indicated that the cross-linking reaction was catalyzed specifically by TGase To further evaluate the specificity of the assay for TGase 1, skin sections from a...
- 11
- 449
- 1
báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf
... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Takahashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, ... corresponding to Aux/IAA genes Motif Transcription Factor Family*1 ([ACGT]GAA [ACGT]){3} TGACAGGT CCAC [AC ]A [ACGT] [AC] [ACGT] [CT] [AC] GG [ACGT]CCCAC GTGG [ACGT]CCC CAACA [ACGT]*CACCTG A [TC]G [AT ]A ... [CT]CT AATATATTT TGTCTC TGACGTGG CCA [ACGT]TG CACCC CC [AT]{6}GG AATAAA [CT]AAA CGTG [TC]G [GC] [GC] [GA]CGCC AGCCGCC CCAAT TATA [AT ]A [TA]AAAG CA [ACGT] [ACGT]TG HSF Helix-turn-helix(HTH) LIM finger...
- 10
- 397
- 0
Development of a novel immersed boundary lattice boltzmann method and its applications
... Organization of The Thesis 23 Chapter Development of Efficient Lattice Boltzmann Method on Non-Uniform 25 Cartesian Mesh 2.1 Standard LBM 26 2.2 Taylor Series Expansion and Least Squares-base Lattice ... Non -Boundary Conforming Method 1.2.1 Sharp interface approach 1.2.2 Diffuse interface approach 1.2.2.1 Immersed boundary method 1.2.2.2 Force calculation in IBM 1.2.2.3 Advantages and disadvantages ... 1.2.2.3 Advantages and disadvantages of IBM The major advantage of IBM is its simplicity and easy implementation This is attributed to the decoupling of the solution of governing equation with the boundary...
- 277
- 412
- 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering distinct signaling cascades and leading ... Chapter 6.1 Discussion Development of a TLR -based two- hybrid assay for the detection of proteinprotein interactions 6.2 158 Investigation of CD14 dimerization and its role in CD14 signal transduction...
- 236
- 494
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ... Heart Yolk sac Brain Embryo A chemistry using antibodies against the pan-EC marker, CD31, the lymphatic endothelial and liver sinusoidal endothelial marker Lyve-1 (lymphatic vessel endothelial...
- 11
- 873
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... representative of at least three measurements under the indicated conditions (C) The relative content of OH• in the H + ParA1, A4 00 and A + ParA1 zones against the H2O zone Mean values ± standard...
- 15
- 479
- 0
Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx
... interferon-gamma in response to mitogen, superantigen and recall viral antigen Vet Immunol Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 Immunopathol 1998, ... of antibodies to rpIL-6 Optimization of the antibody titer was conducted using a check board titration of ELISA In each microplate well, Development of a novel antigen capture-ELISA using IgY against ... sensitive and specific capture-ELISA for the diagnosis of a farm’s sanitary state Materials and Methods Production of recombinant pig IL-6 Cloning of cDNA encoding mature protein: Total RNA was extracted...
- 7
- 400
- 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... contrasting varieties 'Romanesco C3' (a late-maturing, non-spiny type) and 'Spinoso di Palermo' (an earlymaturing spiny type) Here, we report the isolation of the cDNA of a novel acyltransferase involved...
- 13
- 650
- 0
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx
... Phage # TC-83 TrD P676 3880 Mena II 78V Fe37c BeAn8 Pixuna CaAr508 AG80 Control Figure Reactivity of phagemid clones to a wide range of VEEV strains Reactivity of phagemid clones to a wide range ... into a murine IgG 2a kappa antibody, which was designated CUF37- 2a Murine IgG 2a was chosen as the framework as it has equivalent biological and functional activities to human IgG1 The amino acid ... classical hybridoma technology ( 1A4 A-1, 3B 2A- 9 and 1A3 B-7) Humanisation of CUF37- 2a will be essential if this antibody is to find use as an antiviral in humans and these data suggest that CUF37-2a...
- 9
- 290
- 0
Báo cáo y học: " Identification of a novel betaherpesvirus in Mus musculus" docx
... as in the initial analysis DNA of organs and tissue supernatants was extracted using the QiAamp tissue kit according to the manufacturer's instructions (Qiagen, Hilden, Germany) Panherpes consensus-PCR ... Beisser PS, Kaptein SJ, Beuken E, Bruggeman CA, Vink C: The Maastricht strain and England strain of rat cytomegalovirus represent different betaherpesvirus species rather than strains Virology 1998, ... Smith LM, McWhorter AR, Masters LL, Shellam GR, Redwood AJ: Laboratory strains of murine cytomegalovirus are genetically similar to but phenotypically distinct from wild strains of virus J Virol...
- 4
- 281
- 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI- GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore ... for the development and analysis of test interface for wafer level package operation at multi- gigahertz frequencies (about 2.5 to GHz) given the tight geometrical constraints of fine pitch (of the ... mesh media, inhomogeneous media with multilayered composites and applies the models for the development of a novel test interface for wafer level packages (WLP) operating at multi- gigahertz frequencies...
- 202
- 532
- 0
Development of a bioreactor for in vitro engineering of soft tissues
... DEVELOPMENT OF A BIOREACTOR FOR IN- VITRO ENGINEERING OF SOFT TISSUES KYAW MOE (B.Eng (Hons.), YTU, Yangon) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ... through the chamber maintaining steady state Low inlet gas flow rates were maintained such that inexpensive commercially available CO2, O2, and N2 tanks would last for approximately weeks In this system, ... from National University of Singapore designed a bioreactor with spool The actuating unit from that design is made up of a stepper motor (PM 35S-024, Minebea Hamamatsu) actuating via a pair of spur...
- 151
- 253
- 0
báo cáo hóa học: " Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pptx
... quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management FJS conceived of the study, participated in its design and contributed ... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self- report measures were calculated Differences between male and female participants and between ... of the illness itself, but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are assumed...
- 7
- 410
- 0
báo cáo hóa học:" Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pdf
... quality of data management and the manuscript NZ coordinated the assessments in the diabetes outpatient clinic and data management FJS conceived of the study, participated in its design and contributed ... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self- report measures were calculated Differences between male and female participants and between ... of the illness itself, but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are assumed...
- 7
- 395
- 0
Từ khóa: development of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestswhat is the role of mass communication in the development of a countrythe role of communication in economic development of a societythe role of transportation and communication in economic development of a countryrole of agriculture sector in economic development of a developing countrydevelopment of a method to measure consumer emotions associated with foodsdevelopment of a transmmision hand held meter for assessing chlorophyll and nitrogen in fresh leavesfurther development of a secured unifieddevelopment of a spoken languagedevelopment of the embryo sac in plantsdevelopment of the embryo occurs in thedevelopment of a recipe management systemthe design and development of a solar powered refrigeratordevelopment of the fetus occurs in thedevelopment of the embryo occurs in the uterusNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP