Quantum interference between single photons from a single atom and a cold atomic ensemble
Quantum interference between single photons from a single atom and a cold atomic ensemble
... To trap a single atom, we start with an atomic cloud in a magneto-optical trap (MOT) and use an optical dipole trap to trap a single atom at the focus of the lens1 A MOT consists of three pairs ... my stay enjoyable To all my family members, especially my parents, that are always there and have always cared for me No words can express my gratitude to all of you At last, many thanks to all ... generation from the atomic ensemble 2.2 Single Photon from Single Atom Single photon generation from a single atom in cavity has been previously demonstrated for Rb [38, 39, 40, 41] and Cs [42] Basically,...
- 90
- 394
- 0
Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom
... work with him and Sandako while doing HOM measurements Gleb, for always teasing me I still miss that Dzmitry, for his great ideas One can approach him anytime and any day and he is always ready ... residual pump light The pump beams can be adjusted to any value from a linear to circular polarization using Polarizers (P), quarter wave plates (q) A pair of quarter wave plates (q), half wave plates ... the case in a initial atomic beam experiments [48] which had only a very small number of atoms participating in the excitation and decay process at any time A spatially extended atomic ensemble,...
- 124
- 299
- 0
Tài liệu Retrieving a Single Value from a Query pdf
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
- 2
- 312
- 0
Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx
... plasma and CSF HIV-1 RNA levels The subject was placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and ... to as "late" isolates (designated "E" and "L", respectively) Replication kinetics We first examined the capacity of the HIV-1 isolates to replicate in PHA-activated PBMC (Fig 1) The R5 ADA and ... a grant from the American Foundation for AIDS Research (amfAR) to DAM (106669), and grants from the National Institutes of Health to PRG (AI054207) and DG (NS37277) LG and JS are recipients of...
- 12
- 401
- 0
Báo cáo hóa học: " Research Article Inference of a Probabilistic Boolean Network from a Single Observed Temporal Sequence" potx
... perturbation (BNp) is a Boolean network altered so that, at any moment t, there is a probability P of randomly flipping a variable of the current state x(t) of the BN An ordinary BN possesses a stationary ... typical in statistical inference For instance, point estimation of the mean of a distribution identifies a single value as the candidate for the mean, and typically the probability of exactly ... ergodic as a random process and possesses a steady-state distribution By definition, the attractor cycles of a BNp are the attractor cycles of the BN obtained by setting P = A probabilistic Boolean network...
- 15
- 402
- 0
Báo cáo y học: "Surgical treatment for pulmonary metastases from esophageal carcinoma after definitive chemoradiotherapy: Experience from a single institution" doc
... surgical treatment for pulmonary metastases from esophageal carcinoma A major characteristic of this article is that the primary treatment for esophageal carcinoma was confined to definitive CRT, and ... for pulmonary metastases from esophageal carcinoma In this article, we report our institutional experience with surgical treatment for pulmonary metastases from esophageal carcinoma after definitive ... indicated that solitary pulmonary metastasis from esophageal carcinoma was a favorable indicator for surgical treatment [6] In this article, patients with solitary pulmonary metastasis also showed...
- 6
- 498
- 0
Báo cáo y học: " Comorbid mental disorders in substance users from a single catchment area - a clinical study" potx
... http://www.biomedcentral.com/147 1-2 44X/11/25/prepub doi:10.1186/147 1-2 44X-1 1-2 5 Cite this article as: Langås et al.: Comorbid mental disorders in substance users from a single catchment area - a clinical study BMC Psychiatry 2011 11:25 ... sensitivity Br J Psychiatry 1978, 133:42 9-4 35 103 Favre S, Aubry JM, Gex-Fabry M, Ragama-Pardos E, McQuillan A, Bertschy G: [Translation and validation of a French version of the Young Mania Rating Scale ... assessment Aims The main aim of this study is to diagnose all mental disorders in substance users from a single catchment area, without any history of treatment for addiction or psychiatric disorder,...
- 12
- 523
- 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT...
- 10
- 250
- 0
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt
... this article as: Altenbach et al.: Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protein band, individual gamma gliadin peptides obtained from ... Butte 86 gamma gliadins by MS/MS Because neither the NCBI database nor any single EST assembly contained sequences that matched all of the Butte 86 gamma gliadins, specialized databases that included...
- 14
- 325
- 0
Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx
... infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection ... infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection ... contamination during sample preparation for MIRU-VNTR typing, sample preparation for PCR, and the addition of DNA was done in a laminar flow cabinet The H37Rv M tuberculosis strain and water...
- 10
- 403
- 0
Báo cáo y học: "Nef gene evolution from a single transmitted strain in acute SIV infection" ppt
... examined evolution of the viral nef genes from a single transmitted strain Nef, a small accessory protein, was selected because the virus can tolerate significant variability in the nef protein, ... genes in parallel with mathematical/computational modeling [1-3] Major goals of such analyses include the characterization of the transmitted strains, estimating the timing of infection based ... was infected with 100 TCID50 SIVmac239 by intravenous injection Animal r00098 (r98) was infected by intrarectal inoculation with 10 MID50 SIVmac239 Viral RNA was isolated from frozen plasma samples...
- 13
- 201
- 0
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx
... Therefore, a broad range of viruses circulating in a single donor may be potentially transmissible at any one time, consistent Page of 14 with the hypothesis that transmission of viral variants is a random ... gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA 10 P2 gp120 day 63 SGA 11 P2 gp120 day ... July 2011 Published: July 2011 References Kawashima Y, Pfafferott K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, et al: Adaptation of HIV-1 to human leukocyte...
- 14
- 360
- 0
Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"
... focused on the secondary prevention of stroke with APS, and compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy in ischemic stroke patients with APS The ... Int J Med Sci 2010, with APS We therefore compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients ... combination of antiplatelet and anticoagulation therapy may be more effective than single antiplatelet therapy for secondary prevention in ischemic stroke patients with APS 18 Conflict of Interest...
- 4
- 601
- 0
Báo cáo khoa học: Mapping contacts between regulatory domains of skeletal muscle TnC and TnI by analyses of single-chain chimeras potx
... interactions between skeletal muscle TnC( 1–91) and TnI( 98–182), we have constructed two single chain chimeras composed of these domains The chimeras were formed by residues 1–91 of TnC and residues ... the TnC( 1–91) and TnI( 98–182) form a regulatory subunit, and that the first half of the C terminus of TnI is important for this binding Structural information of the interaction of TnC and TnI ... Contacts between skeletal TnC and TnI regulatory domains TnC is dumbbell-shaped protein with two globular domains, each composed of two EF-hand calcium binding motifs, which are connected by...
- 12
- 577
- 0
Từ khóa: 23migrating from a single instance to parallel serverdiffraction from a single square slit2 passing single data values to and from a function5 import data from a single data file622 one three state driver inferred from a single block 655654 inferring one three state driver from a single block 654mechanism and method of single atom pyramidal tip formation from a pd covered w tippreparation of a high quality cdna library from a single cell quantity of mrna using chum rna17 44 use overnight delivery from a single location for selected itemswhat is the estimated risk from a single chest x ray in a childwhat is the estimated risk from a single abdominal ct scan in a childall pigs from a pseudorabies monitored vaccinated feeder pig herd that are transported to a remote growout nursery must be progeny of sows which have been vaccinated with a single official gene altered pseudorabies vaccineduring runtime sharing left multiple swf files can share symbols from a single common swf file during author time sharing right multiple fla files can provide updated symbols to a single fla file that publishes a swf file to play16 42 use overnight delivery from a single location for selected itemsdijkstra s algorithm for finding the shortest distance from a single sourceNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP