0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Playing with tension a computational mode of improvisational accompaniment by secondary rhythmic performer in carnatic music

Playing with tension  a computational mode of improvisational accompaniment by secondary rhythmic performer in carnatic music

Playing with tension a computational mode of improvisational accompaniment by secondary rhythmic performer in carnatic music

... development and validation of a tension model that, assuming restricted sowkhyam, is able to generate alternate variations of secondary accompaniment that are as valid as the original accompaniment ... the database Since each rhythm in the database is distinctly characterized by a single set of accompaniment values, there is always only one accompaniment available for any given musical scenario ... multiple valid accompaniments by modeling the constraints of accompaniment playing, is the problem of interest in this thesis Computational creativity is an emerging field of research in artificial intelligence,...
  • 136
  • 188
  • 0
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt

Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt

... the interaction of PCPs with membranes was predominantly in uenced by initial electrostatic interactions, whereas the interaction of PFPs with membranes was most affected by hydrophobic interactions ... other Central proline in amphipathic a- helix amphipathic a- helical peptides such as magainin [52,53], the initial binding of M17P (K1 ¼ 6.8 · 104 m)1) was much faster than the following insertion ... replacement of a Pro with an Ala maintained or decreased the antimicrobial activity but significantly increased the hemolytic activity In addition, Oh et al [38] reported that a cecropin A magainin...
  • 15
  • 376
  • 0
Báo cáo y học:

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... responses in patients with staphylococcal septicemia against two Staphylococcus aureus fibrinogen binding proteins: clumping factor and an extracellular fibrinogen binding protein Clin Diagn Lab ... IgG antibody levels against PG and TA in sera from healthy individuals and patients with deep-seated and superficial staphylococcal infections S aureus cell wall Healthy Patients with Antigens Individuals ... lysate of Staphylococcus aureus during infection was examined qualitatively by immunoblot analysis of sera from patients of both the group Figure shows the IgG immunoblot profile of the sera of patients...
  • 8
  • 524
  • 2
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Towards a Computational Treatment of Superlatives" pptx

... Bing Liu, Johan Bos and Malvina Nissim, and Jimmy Lin and Dina DemnerFushman for making their data available References Kisuh Ahn, Johan Bos, James R Curran, Dave Kor, Malvina Nissim and Bonnie ... forms and postulated a new classification for them My present efforts are on the creation of a gold standard data set for the extraction task As superlatives are particularly frequent in encyclopaedic ... constructions and the main challenges that have to be faced, described previous computational approaches and their limitations, and discussed applications in two areas in NLP: QA and Sentiment...
  • 6
  • 446
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A COMPUTATIONAL VIEW OF THE COGNITIVE SEMANTICS OF SPATIAL PREPOSITIONS*" ppt

... construals of the same information in the process of conventional imagery (thesis 5) LEVEL OF SPECIFICITY The level of specificity of conventional imagery addresses the issue of the degree of detail ... DEPICTIONS Here the x-axis points direction of the halfaxis of the particular side of the reference axis in the DCS; and in the case of "in front of" y is the perpendicular direction in the horizontal ... left of the long desk The chair in front of the desk is near the short desk." OF PREDICATION OTHER The concept of the scale relates to the object dependency of the degree of proximity and directional...
  • 7
  • 552
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf

... lexical knowledge base, along the lines of Navigli and Lapata (2010) At its core, the API leverages an in-house Java library to query paths and create semantic graphs with BabelNet The latter ... Thanks to carefully designed Java classes, we are able to accomplish all of this in about 20 lines of code Multilingual WSD API We use the BabelNet API as a framework to build a toolkit that allows ... (bn:02945246n) and E TH ICAL BANKING (bn:02854884n, from Italian) An API for multilingual WSD BabelNet API BabelNet can be effectively accessed and automatically embedded within applications by means of a...
  • 6
  • 400
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Model of Text Reuse in Ancient Literary Texts" potx

... two training hypotheses listed in Table 2, yielding two models, B and J Table shows the increasing accuracy of both models in describing the text reuse in Ltrain as more features are incorporated ... global linear models in (Collins, 2002), we cast this task as learning a mapping F from input verses x ∈ X to a text- reuse hypothesis y ∈ Y ∪ { } X is the set of verses in the target text In our ... some of the derived sentences Text Ltrain Ltest Researcher (Bovon, 2002) (Jeremias, 1966) (Bovon, 2003) (Jeremias, 1966) Model B J Table 2: Two models of text reuse of Mark in Ltrain are trained...
  • 8
  • 536
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Model of Social Perlocutions" docx

... person, or simply out of habit Conclusions This paper has presented a computational model of the sodal perlocutionary effects of speech acts Our model extends previous formal modela of speech acts to ... part of text generation systems Our M o d e l There are two key questions to address in forming a computational model of social perlocutions: • What are the possible socially-relevant effects of ... different effects? 3.1 Social Perlocutionary Effects We have developed a taxonomy of social perlocutionary effects of speech acts These effects are defined in terms of mental attitudes of the hearer,...
  • 7
  • 338
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... Semantic patterns in complex noun phrases fall into two types: part names and other noun phrases Names for pieces of equipment often contain complex noun sequences, i.e stacked nouns The relationships ... sequences A major feature of noun phrases in this set of messages is the presence of many long sequences of left modifiers of nouns, (3) {3) (a) forward kingpost sliding padeye unit (b) coupler ... having to give highly descriptive names to parts in terms of their function and relation to other parts Modifiers of nouns include nouns and adjectives In Left Modifiers of Nouns Type Total noun...
  • 4
  • 515
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Theory of ProseStyle for Natural Language Generation" ppt

... J (1985a) WAGs as a Grammatical Formalism for Generation", pr~eedings of the 23rd Annual Meeting of the Association for Computational Linguistics, University of Chicago McDonald D & Pustejovsky ... Its implications for natural language generation", International Journal of Computers and Mathematics, 9(1) Spring 1984 McDonald,D & E I Conklin (in preparation) "At the Interface of Planning and ... looked at our treatment of four of the five points which we said at the onset of this paper had to b,~ considered by any theory of prose style The fifth point, the kinds of information stylistic...
  • 7
  • 415
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A COMPUTATIONAL MODEL OF THE SYNTAX-PROSODY INTERFACE IN TOKYO JAPANESE" doc

... appears as The syntax-prosody interface (SPI) is defined as a subset of For instance, the optionality of minor phrase formation follows from the inclusion of ... j < i The admissible prosodic labellings are defined as those which extend the following prosodic rules in (9) (+(~), the mother is constrained to be a major MINOR PHRASING phrase, while in (10) ... two sets of constraints - over the relative values of its daughter's registers, and on the pitch of the intermediate L% tones These constraints are discussed below The parameter settings entail...
  • 8
  • 484
  • 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

... KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) for KK mutation SDS/PAGE and western ... heterogeneity and substrate sizes Our data also have relevance for the biological roles of the TatAdCd and TatAyCy systems in B subtilis Here, we have shown that both the TatAdCd and TatAyCy systems are able...
  • 12
  • 445
  • 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... sulfur sulfur interactions in defining the catalytically competent binding mode of CoA in the active site The pantetheine binding tunnel of biosynthetic thiolase When CoA binds to Z ramigera biosynthetic ... thiolase superfamily The results obtained indicate that the sulfur atoms of both the enzyme and the substrate are important for the correct productive mode of binding of CoA in the thiolase active site, ... terminal sulfur atom by oxygen, the binding mode of the ligand also changes, resulting in a nonproductive binding mode Our data indicate an important role for the interactions between the CoA substrate...
  • 13
  • 472
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx

... constitute the model of metaphor comprehension are common to many language understanding systems (Schank, Wilks, L)IR group, etc.) The comprehension of metaphor does not require a special set of processes ... the conditions necessary for the strategy to be employed CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension systems ... with the larger and richer knowledge domains which have to be handled The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are the...
  • 2
  • 311
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A COMPUTATIONAL THEORY OF DISPOSITIONS" pdf

... the elements of U It is of interest to observe t h a t if p a ( t ) - and s(t,n) = ~ a ( u ) , (4.9) that is, the grade of membership of u in A is equal to the degree of similarity of u to t, ... similarity of u to t, then the degree of typicality of t is unity This is reminiscent of definitions of prototypicality (Rosch, 1978) in which the grade of membership of an object in a category is assumed ... -summary of typical elements of A In this sense, a prototype is not, in general, an element of U whereas a typical element of A is, by definition, an clement of U As a simple illustration of this...
  • 7
  • 378
  • 0

Xem thêm

Từ khóa: a computational treatment of sentencea computational theory of prosestylea computational theory of perspectivea computational model of referencea computational theory of dispositionsa special mode of languagea computational treatment of koreantowards a computational treatment of superlativesa computational model of texttoward a computational theory of conscious processinga new mode of productiona new mode of authentication access using visual evoked potentialsdecades product labeling has become a popular policy tool particularly with respect to the provision of nutrition and health information it culminated in the passage of the nutritional labeling and education act nlea in 1990a novel mode of traf signalingexplain mode of heat transfer by conductionGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ