0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Molecular analysis of the p14 ARF hdm2 p53 regulatory pathway in breast carcinoma

Molecular analysis of the p14 ARF hdm2 p53 regulatory pathway in breast carcinoma

Molecular analysis of the p14 ARF hdm2 p53 regulatory pathway in breast carcinoma

... representation of the cell cycle, showing the role of p53 at the G1/S checkpoint Figure 10 Schematic representation of the p1 4ARF- hdm2- p53 regulatory pathway The binding of p53 to hdm2 results in inactivation ... 1.5.2 The role of p53 at the G1/S checkpoint of the cell cycle 22 1.5.3 Inactivation of p53 23 1.5.4 Significance of p53 in breast carcinogenesis 25 p1 4ARF- hdm2- p53 REGULATORY PATHWAY 26 1.6.1 hdm2 ... Invasive Breast Carcinomas Table Missense Mutations in p53 Identified in of 14 Human Breast Cell Lines Table Genetic Alterations in the p1 4ARF- hdm2- p53 Pathway in 14 Human Breast Cell Lines Table...
  • 198
  • 681
  • 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were performed with GST -C2 domain fusion ... (0–0.5 m) at a flow rate of 1.0 mLÆmin)1 The wildtype and mutated forms of recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In...
  • 13
  • 455
  • 0
báo cáo hóa học:

báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx

... loading Results BPA induces dose dependent apoptosis in acute myeloid leukemia cells To understand the potential role of BPA in biological systems of leukemias we tested the action of BPA in three ... activity of these compounds [17,18] In the present manuscript, we decided to investigate the effects of different doses of BPA on acute myeloid leukemia models to understand the mechanism(s) of BPA ... at the present, our data suggest that the contact or the assumption of BPA might increase the effects of a on-going treatment in humans, apart, of course, having effects on its own Finally, the...
  • 8
  • 603
  • 0
Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation

Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation

... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacterium as an invader initiates the ... that mutagenesis of the dynein-interacting motifs of viral proteins caused non-infective viruses (Merino-Gracia et al., 2011) 1.1.5 The exploitation of microtubules by Agrobacterium? The molecular...
  • 208
  • 200
  • 0
Molecular analysis of the breeding biology of the asian arowana (scleropages formosus)

Molecular analysis of the breeding biology of the asian arowana (scleropages formosus)

... attainable size, big and long fins of the RG1 and the intense colouration of the MG One of the shortfalls of the hybrid is the large variation of phenotypes produced in their offsprings which is common ... particularly the subfamily Osteoglossinae We hope that our work will enhance the understanding of the evolution of the breeding biology of teleost, and provide a genetic glimpse into the biology of ancient ... 4.3 The advantages of being able to sex the adult Asian arowanas 132 4.4 The change in the breeding relationships in a pond after the death of a highly productive male indicates the presence of...
  • 184
  • 327
  • 0
Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells

Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells

... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic components of Agrobacterium The T- DNA, vir genes ... course analysis of T- DNA accumulation inside the wild type and las17 yeast cells 46 3.5 Detection of individual T- DNA molecules inside the yeast cells 50 3.5.1 Percentage of yeast cells with T- DNA...
  • 74
  • 210
  • 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... establish the link between potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in...
  • 109
  • 382
  • 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

... 17 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G. W BUSH IN THE U. S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A DATA ANALYSIS AND DISCUSSION 3.1 Analysis of data 3.1.1 Lexical choice By referring ... 14 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G. W BUSH IN THE U. S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A The data speech was delivered by President G W Bush on the inauguration day of ... AN ANALYSIS OF THE INAUGURAL ADDRESS BY G. W BUSH IN THE U. S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A VINH, 2007 VINH UNIVERSITY DEPARTMENT OF FOREIGN LANGUAGES AN ANALYSIS OF THE...
  • 44
  • 578
  • 0
Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

... that the amino group at carbon of the guanine ring may interact with the side chain of Glu309, whereas the carbonyl group at position of the guanine ring may interact with the hydroxyl group of the ... structures of the EhPGK obtained using the modeller program (Fig S1), it was found that the only difference in the amino acids that bind the purine ring was the presence of Val instead of Leu at ... due to the almost 60% identity in their sequences,  95% of their main ˚ chain atoms being expected within 1.5 A, according to Baker & Sali [28] The residues that bind the adenine ring of ADP...
  • 11
  • 449
  • 0
Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc

Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc

... the only protein with which one can biochemically assay both DNA endonuclease and RNA maturase activities in vitro This investigation provides the first step in the study of the relationship between ... stringent concentration of KCl, there was a correlation between inhibition of endonuclease activity and inhibition of splicing activity indicating that RNA binding can be monitored by measuring ... available and its binding affinity is not altered by the presence of DNA in the DNA binding site Interestingly, when nM RNA and 10 nM DNA were added simultaneously to a limiting amount of protein in...
  • 12
  • 483
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Analysis of the Tradeoff between Delay and Source Rate in Multiuser Wireless Systems" docx

... is the target delay and ε is the probability of exceeding it On the other hand, in multiuser communications the capacity of the channel is no longer fully characterized by a single number Instead, ... , is obtained as the sum of the individual user rates, each of them with its own delay constraint: U CDt , = u=1 Ru t ,ε , D (22) with Dt and being the vectors with the target delays and probabilities ... expressions of the achievable users’ rates in a wireless system under the conditions stated by the MAC layer: a selected scheduling discipline and a QoS constraint given in terms of a delay constraint and...
  • 13
  • 530
  • 0
Báo cáo y học:

Báo cáo y học: "Sequence analysis of the Epstein-Barr virus (EBV) BRLF1 gene in nasopharyngeal and gastric carcinomas" docx

... BRLF1 gene from multiple tissues Based on the phylogenetic tree, we identified distinct subtypes of BRLF1 gene in the specimens of Northern China Two subtypes, BR1-A and BR1-C, were dominant in the ... TWs The frequency of BRLF1 subtypes in EBVaGCs, NPCs, and TWs of healthy donors was summarized in Table Fisher’s exact test was used to determine the difference of the BRLF1 subtypes among the ... Observed BRLF1 sequence variations in EBVaGC, NPC biopsies and TWs of healthy donors in Northern China The numbers in the first row correspond to the amino acid positions and the numbers in the second...
  • 8
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: " The role of the humoral immune response in the molecular evolution of the envelope C2, V3 and C3 regions in chronically HIV-2 infected patients" pdf

... diversity (Shannon's Figure intensity and distribution of positively selected sites in the C2, V3 and C3 regions along the course of HIV-2 infection Frequency, Frequency, intensity and distribution of ... evolution of the HIV-2 env gene In the present study we analyze, for the first time, the molecular evolution of the env C2V 3C3 regions in chronically HIV-2 infected patients over a two to four year period ... along the course of infection Figure Frequency and distribution of potential N-glycosylation sites in the C2, V3 and C3 regions along the course of infection The frequency and distribution of potential...
  • 12
  • 308
  • 0
Báo cáo y học:

Báo cáo y học: " High cell density and latent membrane protein 1 expression induce cleavage of the mixed lineage leukemia gene at 11q23 in nasopharyngeal carcinoma cell line" ppt

... doi :10 .11 86 /14 23- 012 7 -17 -77 Cite this article as: Yee and Sim: High cell density and latent membrane protein expression induce cleavage of the mixed lineage leukemia gene at 11 q23 in nasopharyngeal ... High cell density induces apoptosis and subsequent cleavage of the MLL breakpoint cluster region (bcr) To investigate the role of high cell density- induced apoptosis in causing chromosome cleavage, ... demonstration of apoptosis-induced cleavage of the MLL bcr in NPC cells Since the MLL gene locates at 11 q23 [18 ], a common chromosome deletion site in NPC [2], our findings support the possibility...
  • 8
  • 386
  • 0
Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

... measure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS ... dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in the medaka PGC at stage 24 and localized in the nuage 3D imaging of Olvas GFP ... and FRAP analyses of OlvasGFP in the PGC FCS was used to measure the movement of OlvasGFP into the cytosol out of the nuage region of the PGC Representative correlation curves are shown (A) The...
  • 9
  • 655
  • 0

Xem thêm

Từ khóa: functional analysis of the cervicalfunctional analysis of intergenicanalysis of the supremeanalysis of the germanthe turn of the screw analysis of the governessgive a critical analysis of the concept of self defence in public international law and international humanitarian lawpestel analysis of the uk fast food industrycalculate the molar mass and molecular formula of the solidspectral analysis of the supreme courtnatural language interfaces to databases an analysis of the state of the artcharacter analysis of the governess in the turn of the screwcritical analysis of the novel the old man and the seacritical analysis of the book the old man and the seaanalysis of the banking sector in zimbabwequantitative analysis of the impact of the child support grantcritical analysis of the german ideologyNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP