Distribution of betaine gaba transporter BGT 1 in excitotoxic brain injury and its role in osmoregulation in the brain
Distribution of betaine gaba transporter BGT 1 in excitotoxic brain injury and its role in osmoregulation in the brain
... swelling following head injury or stroke In summary, the present study has revealed the distribution of betaine/ GABA transporter BGT- 1 in normal brain and in excitotoxic brain injury, as well as the ... function in the brain BGT- 1 is capable of transporting both betaine and GABA, as examined in Xenopus oocytes and various cell lines But the physiological substrate of BGT- 1 in the brain remains to ... hyperosmolarity-induced increase in the transcription of BGT- 1 gene and the resulting increase in BGT- 1 synthesis 3 .1. 5 .1 Tonicity-responsive enhancer (TonE) Following the cloning of the entire BGT- 1 gene...
- 196
- 215
- 0
Báo cáo hóa học: " Effects of Shape and Strain Distribution of Quantum Dots on Optical Transition in the Quantum Dot Infrared " doc
... valence band in the position The compressing and stretching condition of bottom in the pyramid QD is the same as the lens-shaped QD The difference of QD shape makes the strain distribution rather ... calculation, the QDIP system is made up of InAs/GaAs So, the second term has the same impact on the strain distribution In the following, we will have a look at the relationship of the strain distribution ... expansion in the variations of the bond length and the angles between the bond and its nearest neighbor bonds Under the rubric of shortrange contributions and by following the general notations in...
- 6
- 380
- 0
Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation
... over-expression of p21WAF1 inhibits DNMT1 73 3 .1. 1.7 TSA -mediated induction of p21WAF1 results in inhibition of 76 DNMT1 3 .1. 1.8 TSA -mediated induction of p21WAF1 is independent of p53 85 3 .1. 2 Transcriptional ... between DNMT1 and p21WAF1 in the 63 cell cycle 3 .1. 1 .1 3 .1. 1.2 DNMT1 expression in the cell cycle 63 WAF1 in DNA 67 p21WAF1 68 Transient over-expression of DNMT1 does not inhibit 71 Inverse relationship ... methylase 17 1. 3.3b DNMT1 interacts with Polycomb Group (PcG) proteins 17 1. 3.3c DNMT1 interacts with UHRF1 18 Transcriptional suppression 19 1. 3.4 iv 1. 4 DNMT1 in the Cell Cycle 1. 4 .1 21 1.4.2 E2F1/RB...
- 208
- 387
- 0
Báo cáo khoa học: Insulin like growth factor-1-induced phosphorylation and altered distribution of tuberous sclerosis complex (TSC)1⁄TSC2 in C2C12 myotubes pptx
... Effects of inhibitor treatment (wortmannin and U0126) on insulin ⁄ IGF-1-induced phosphorylation of PI3K ⁄ Akt ⁄ mTOR-dependent signaling in C2C12 myotubes Fig S2 Complex formation of TSC1 and TSC2 ... versus control group (P < 0.05) Phosphorylation of Akt and S6K1 was induced within 10 min, and was maintained for at least 60 Altered distributions of TSC1 and TSC2 proteins were also detected on the ... indicated that Akt in uences mTOR signaling by regulation of the protein complex of tuberous sclerosis complex (TSC)1 ⁄ TSC2 [9–12] The TSC1 ⁄ TSC2 protein complex is a heterodimer composed of...
- 12
- 411
- 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
... requires protein translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general ... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... constitute the minimal transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain...
- 7
- 658
- 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... and PAI-1 on the rate of thrombin/ PAI-1 complex formation For various combinations of kon and koff for the thrombin/ TM interaction, the concentration of all reactants and intermediates was calculated ... PAI-1 The rate of thrombin inhibition by 1.5 lM PAI-1 was measured in the presence of increasing concentrations (0–800 nM) of solulin Solulin lacks the transmembrane domain and does not contain ... constructed and analyzed as described [6] The effect of increasing concentrations of solulin on the inhibition of thrombin and thrombin- VR1tPA by PAI-1 was determined To that end, a solution of...
- 10
- 483
- 0
Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx
... that the F-11 cells not only express the rat VRL-1, but also the mouse VRL-1 and that the mouse variant is derived from the F-11 parental cell line N18TG2 This finding is of interest when VRL-1 ... A, B and D of F-11 cells again separated into two bands The slower migrating band always corresponded to the rat brain control, and the faster migrating band to the N18TG2 control (Fig 5) The ... characteristics of the capsaicin sensitive Vanilloid receptor VR1 transiently transfected in the rat dorsal root ganglia derived cell line F-11, a hybridoma of mouse neuroblastoma and rat dorsal root ganglion...
- 8
- 439
- 0
Báo cáo khoa học: "Tissue distribution of bovine viral diarrhea virus antigens in persistently infected cattle Taekyun Shin* and Helen Acland1" ppt
... exocrine glandular acini (Fig Tissue distribution of bovine viral diarrhea virus antigens in persistently infected cattle 83 Table Summary of anatomic sites and immunohistochemical intensity of BVDV ... localization of bovine viral diarrhea virus, a single-stranded RNA virus, in ovarian oocytes in the cow Vet Pathol 1998, 35, 253-259 Grooms, D L., Brock, K V and Ward, L A Detection of bovine viral diarrhea ... Booth, P J., Stevens, D A., Collins, M E and Brownlie, J Detection of bovine viral diarrhoea virus antigen and RNA in oviduct and granulosa cells of persistently infected cattle J Reprod Fertil 1995,...
- 4
- 508
- 0
Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf
... demonstrating an increase in the level of caveolin-1 phosphorylation in irradiated rats located primarily in the microglial and vascular endothelial cells of the spinal cord The findings suggest that the ... activation in the microglia are associated with the phosphorylation of caveolin-1 in the spinal cord of irradiated rats, leading to the activation of microglia Furthermore, gamma irradiation induces inflammation ... showed that the level of p -caveolin-1 expression was significantly higher in the spinal cord at 24 h PI (0.267 ± 0.036; n = rats; p ＜ 0.05 vs nor- p -caveolin-1 in the spinal cord of irradiated...
- 5
- 205
- 0
Báo cáo khoa học: "Assessment of the spatial distribution of light transmitted below young trees in an agroforestry system S Meloni" pptx
... INTRODUCTION Agroforestry is defined as a multiple landuse system in which woody plants are combined with annual crops and/or animals on the same unit of land (Jarvis,1991) In these systems, the tree canopy ... distribution of transmitted radiation Tree structure and light distribution below trees were measured in an agroforestry system consisting of wild cherries (Prunus avium) and a pasture of Festuca ... at the scale of the sensor Therefore this should increase the minimum of transmitted radiation measured under the trees and blur the edge of the shaded area Second, small errors in the canopy structure...
- 21
- 269
- 0
Báo cáo y học: "The role of interleukin-1 in the pathogenesis of human Intervertebral disc degeneration" pdf
... staining for phenotypic markers in chondrocyte-like cells from human intervertebral discs Immunohistochemical staining for collagen phenotypic markers in chondrocyte-like cells from human intervertebral ... Suda A: Cathepsin G in degenerating and healthy discal tissue Clin Exp Rheumatol 1999, 17:197-204 Gruber HE, Hanley EN Jr: Analysis of aging and degeneration of the human intervertebral disc Comparison ... every other day Assessment of re-differentiated state in alginate To ensure that the phenotype of cells treated with IL-1 were similar to the phenotype of cells within the IVDs in vivo, the cell...
- 14
- 403
- 0
Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt
... was increased in hypoxic chondrocytes lacking HIF-1α, to twice R909 Our findings show the potential involvement of HIF-1α expression in the progression of articular cartilage degeneration In patients ... radicals) may induce the expression of HIF-1α in articular chondrocytes IL-1 has been shown both to inhibit chondrocyte anabolic activity, including the down-regulation of proteoglycan synthesis, ... Catabolic factors induce the expression of HIF-1α protein in human articular cartilage (a )Hypoxia-inducible factor 1α (HIF-1α) protein was accelercartilage ated by IL-1β or H2O 2in cultured chondrocytes...
- 11
- 385
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... Colosia AD, Donahue JP, Lin YZ, Hawiger J: Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylate the amino acids serine-63 ... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense...
- 10
- 462
- 0
Từ khóa: 1 in the case of a body corporate beneficial owner means any individual who—plans the company shall also disclose the information required in section 1 of note 14 for provisions recognised in the balance sheet and the followingrecorded the company shall disclose the information required in section 1 of note 14 for provisions recognised in the balance sheetclinical scenario summary recommendations for antiretroviral drug use by pregnant hiv infected women and prevention of perinatal transmission of hiv 1 in the united stateschange in the distribution of students full time equivalent enrolled in tertiary education and in advanced research programs by control of institutions between 1998 and 2006 pointschange in the distribution of funding to higher education institutions by stakeholder between 1995 and 2005 and change in public funding and public funding per student to higher education institutions 1995 2005distribution of total direct lax related jobs in southern california in 1996nghia pham thien ngoc nguyen quoc tuan 2011 research the concentrations placenta growth factor plgf and soluble fms like tyrosin kinase 1 sflt 1 in the serum of pregnant women at risk of pre eclampsia vietnam medicine no 384 8 2011 pp 99 104nghia pham thien ngoc nguyen quoc tuan 2011 research the concentrations of placenta growth factor plgf and soluble fms like tyrosin kinase 1 sflt 1 in the serum of normal pregnant women medical practice no 12 2011 pp 16 192014 evaluation of hypoglycemic activity of total lignans from fructus arctii in the spontaneously diabetic goto kakizaki rats journal of ethnopharmacology 151 1 pp 548 555patterns of hippocampal neuronal loss axon reorganization in the dentate gyrus in mice with type 1 type 2 neuronal loss and their comparison with the control micesulfides on taurine transporter gene expression in the gill of the deep sea mussel bathymodiolus platifrons which harbors a methanotrophic symbiont1β in the lungs of infected caspase 1 deficient mice as compared to its wild type counterpartsthe papyrus of ani dealt with what occurred in the afterlifeschedule of english proficiency test for teachers in the philippinesNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ