Numerical analysis of a brushless permanent magnet DC motor using coupled systems
Numerical analysis of a brushless permanent magnet DC motor using coupled systems
... to characterize the material Another type of material that is characterized by a broad hysteresis loop is called hard magnetic material 1.3.1 Hard magnetic materials (Permanent magnets) Permanent ... commutator motor: The construction of a permanent magnet DC motor( PMDC) is similar to a DC conventional motor with the electromagnetic excitation system replaced by permanent magnets A PMDC commutator ... have made using BLDC motor a viable alternative The developments and applications of the BLDC motors have been greatly accelerated by improvements in permanent magnet materials, especially rare-earth...
- 222
- 1,039
- 0
Standards for efficiency of electric motors permanent magnet synchronous motor technology
... and R McElveen, “InIMPORTANCE OF duction vs permanent magnet motors, ” IEEE now profit from the advantages of PM Ind Applicat Mag., vol 15, no 6, pp 28–35, motors For single-speed applications, ... high motor efficiency when the motor is designed for and operated at 60 Hz instead of 50 Hz The difference in efficiency between 50 and 60 Hz varies with the number of poles and the size of the motor ... 0.1 10 Motor- Rated Power (kW) 100 IE3 Efficiency Levels for 50 Hz IE3 Efficiency Levels for 60 Hz Adapted Ultrapremium Efficiency Levels for 50 Hz Commercial Ultrapremium Efficiency Levels for 60...
- 8
- 396
- 1
Computational analysis of a permanent magnet synchronous machine using numerical techniques
... is vital to machine analysis as it is a fast and low-cost way of predicting machine performances Traditional analytical methods, such as lumped parameter models are computationally fast and simple ... It also deals with the parameter estimation of permanent magnet synchronous machines using both experimental and computational methods A line-start interior permanent magnet synchronous machine ... Permanent Magnets The properties and performances of a permanent magnet machine are greatly affected by the characteristics of permanent magnets Therefore proper representation of permanent magnet...
- 285
- 990
- 0
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
... knowledge of the non sinusoidal permanent magnet synchronous motor We are so able as well to analyse the classical control laws such as 120' voltage control for example, as to deduce of this new ... electromotiveforces, the motor being not supply Park's transformation AAer this first transfoxmation, the Pa& transfomation allows us to work in the rotor's reference, through a rotation of an angle PO.Using the ... PROPOSAL OF AN EXTENSION OF THE PARK'S TRANSFORMATION Classical Park's transformation is in fact the succession of two transfomations The torque is then given by: T, = p.(@~,.io+@'did+@'q.iq) For a...
- 6
- 438
- 2
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... (1974) As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave force on the cylinders ... Remarks The wave forces acting on two cylinders and three cylinders are computed by using boundary element method The numerical results are in good agreement with those of Chakrabarti (1978) and ... xạ(Diffraction phenomenon) As an incident wave impinges on the cylinder, a reflected wave moves outward On the sheltered side of the cylinder there will be a “shadow” zone where the wave fronts are...
- 29
- 422
- 0
FAULT DIAGNOSIS OF PERMANENT MAGNET SYNCHRONOUS MOTOR BASED ON MECHANICAL AND MAGNETIC CHARACTERISTIC ANALYSIS
... FAULT DIAGNOSIS OF PERMANENT MAGNET SYNCHRONOUS MOTOR BASED ON MECHANICAL AND MAGNETIC CHARACTERISTIC ANALYSES YU YINQUAN A THESIS SUBMITTED FOR THE DEGREEM OF DOCTOR OF PHILOSOPHY ... COMPUTATION OF UNBALANCED MAGNETIC PULL AND MECHANICAL UNBALANCED FORCE IN MOTOR 64 5.1 Fundamental theory of electromagnetic force calculation 64 5.2 Introduction of Finite Element Method on Magnetic ... INTRODUCTION and motor fault type and fault position can be indicated precisely Numerous studies have been done on the motor fault analysis using vibration signals Mathematical Model of Permanent Magnet...
- 187
- 597
- 0
Design optimization of permanent magnet synchronous motors using response surface analysis and genetic algorithm
... The development of Permanent Magnet Machines 1.1.2 Features of permanent magnet motors Permanent magnet synchronous motors iii 1.2.1 Structures and operating principles ... with the analysis and design of buried type Interior Permanent Magnet Synchronous Motors (IPMSM) The objective is to develop a design optimization procedure for this type of motors that is more ... List of Figures 1.1 Magnetic characteristics of the main class of permanent magnets [2] 1.2 Evolution of the magnetic material during the 20th century [2] 1.3 Partial demagnetization of a permanent...
- 176
- 736
- 0
Numerical analysis of externally prestressed concrete beams part 2
... surface of cross section -118- 900 21 50 21 50 27 5 D2 D1 1700 25 0 P 325 P 1800 1700 100 520 0 Beam s A1 and A2 21 50 21 50 900 27 5 P D2 D1 1700 1800 375 325 P 1700 520 0 Beam s B1 21 50 21 50 900 27 5 D1 D2 ... e2θ ; * v1 = v1 ; * v2 = v2 ; θ 1* = θ ; * 2 = 2 ; where e1 and e2 are the eccentricities of cable at the deviators and 2, respectively -114- (6.7) u2*,v2*,θ 2* Cable v1 u1 e2 v2 θ 2* 2 u2 ... responses of beams A1-B1 120 Applied load [kN] 100 80 60 40 Beam A2 20 Calc Exp Calc Exp 0.08 0.1 Beam B2 -0. 02 0. 02 0.04 0.06 0. 12 Displacement [m] b) Load-displacement responses of beams A2-B2 Fig.6.14...
- 34
- 384
- 1
Numerical analysis of externally prestressed concrete beams part 1
... [K 11 ] 1 ({ΔF1 } + {R1 } − [K 21 ]{ΔU }) (2.22) {ΔF2 } = [K 22 ]{ΔU } + [K12 ]{ΔU } − {R2 } (2.23) K 12 ⎤ K 22 ⎥ ⎦ ⎧ ΔU ⎫ ⎬ ⎨ ⎩ΔU ⎭ (1) ⎧ ΔF ⎫ ⎧ R ⎫ = ⎨ 1 +⎨ 1 ⎩ΔF2 ⎭ ⎩ R2 ⎭ ⎡ K 11 ⎢K ⎣ 21 Solving ... (3 .18 a) 12 K 6K 12 K 6K ⎤ ⎡ ⎢0; − L3 ; − L2 ; 0; L3 ; − L2 ⎥ ⎣ ⎦ 12 K 1+ L2 (3 .18 b) ⎡ 12 ⎛ 12 K ⎞ 6 12 ⎛ 12 K ⎞ ⎤ 0; − + x; ⎜ − − ⎟ + x; 0; − x; ⎜ − ⎟ + x⎥ ⎢ L⎠ L ⎦ 12 K L L L L ⎝ L ⎝ L L ⎠ L 1+ ... element of matrix [Kc] can be defined as below equations: M N K c 11 = ∑∑ j =1 k =1 K c12 = M N ∑∑ M N L2 i b jk E jk j =1 k =1 K c13 = ∑∑ b jk E jk TsL4 i b jk E jk j =1 k =1 TsLi (q k +1 − q k...
- 96
- 510
- 1
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators ... considered the same parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy...
- 14
- 416
- 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)
... types of Darrieus rotors are mainly available, namely troop skein (Eggbeater) Darrieus rotor and H-Darrieus rotor H-Darrieus rotor was in the same patent of 1931[2] It has two to three airfoil shaped ... 0.265 at a TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% and that of computational Ct from experimental ... 23 (a) Variation of Ct with TSR, and (b) deviation of computational Ct from experimental Cp for H/D ratio 2.10 (a) (b) Figure 24 (a) Variation of Cp with TSR, and (b) deviation of computational...
- 16
- 364
- 0
Reliability analysis of a power system based on the multi state system theory
... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi- state system ... reliability theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the...
- 4
- 407
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) ... of a small heat shock /a- crystallin protein (p26) in encysted embryos of the brine shrimp, Artemia franciscana Am Zool 39, 836–847 Liang, P & MacRae, T.H (1999) The synthesis of a small heat shock /a- crystallin...
- 10
- 495
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I, Hughes D & Liljas A (2000) Structure ... Structure 1, 3 5–5 0 Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid- resistant mutants...
- 15
- 474
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBPA (A,< /b> C) ELISA Recombinant His-tagged FnBRB (A)< /b> and < /b> FnBRA (C) and < /b> their ... fnbB P1 fnbA fnbB spa Wild type spa::Kanr fnbA::Tetr fnbB::Ermr spa::Kanr fnbA::Tetr fnbB::Ermr P1 fnbA fnbB spa (pCU1 fnbA+) spa::Kanr fnbA::Tetr fnbB::Ermr (pCU1::fnbA+ Cmr) P1 fnbA fnbB spa...
- 16
- 560
- 0
Từ khóa: morphological analysis of a large spontaneous speechequity analysis of a project414 algebraic analysis of a logic circuit with nand and nor gates772 feedback analysis of a d latchmonte carlo analysis of a pressure sensospecialist s analysis of a series of dna samplesdesign and fe analysis of a 150 kw machinean analysis of a successful emergency telemedicine ventureanalysis of a uk portfolioanalysis of a suspectprogram windowsanalysis of a mixing processanalysis of a rd unitanalysis of a differential fluid element in laminar flowenergy analysis of a system with on off type capacity controlglioma extent of resection and ultra low field iomri interim analysis of a prospective randomized trialNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ