0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4

... competing factors which will influence the stress state of the nanocrystals in dielectrics, one is the capping effect and the other is temperature-dependent intrinsic tensile strain of SiN film ... atoms and therefore the growth of the nanocrystals In addition, it is interesting to note from the inset of Figure 7.1 (e), unlike the nanocrystals of the RTA sample shown in the inset of Figure ... hence resulting in a build-up and increase in stress On the other hand, a furnace annealing at 800°C for 15 minutes allows the growth of the nanocrystals due to its longer annealing time This...
  • 23
  • 209
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 1

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 1

... 4 .10 : XTEM image of Sample B annealed at 10 00°C in forming gas (10 % H2 + 90% N2) for 15 minutes Figure 4 .11 : XTEM image of Sample C annealed at 800°C in forming gas (10 % H2 + 90% N2) for 15 minutes ... image of Sample A annealed at 800°C in forming gas (10 % H2 + 90% N2) for 15 minutes Figure 4.3: XTEM image of Sample A annealed at 900°C in forming gas (10 % H2 + 90% N2) for 15 minutes The inset ... between 800°C to 10 00°C for 15 minutes in forming gas (10 % H2 + 90% N2) Figure 4.7: Raman spectra of Sample C annealed between 800°C to 10 00°C for 15 minutes in forming gas (10 % H2 + 90% N2)...
  • 22
  • 316
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 2

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 2

... comparison of the growth of Ge nanocrystals in silicon oxide and HfAlO matrices - 1 02 - Chapter 5 .2 Results & Discussions II Ge nanocrystals in HfAlO matrix In order to synthesize the Ge nanocrystals in ... almost insoluble in silicon oxide [20 ,21 ], whereas it has been found that thermal processing of HfO + Ge systems can lead to the formation of hafnium germinate (HfGeOx) [22 ,23 ] The formation of the ... 20 04 [ 12] Q C Zhang, N Wu, L K Bera, and C X Zhu, “Study of Germanium Out-Diffusion in HfO2 Gate Dielectric of MOS Device on Germanium Substrate”, Mater Res Soc Symp Proc., vol 829 , pp 449, 20 04...
  • 23
  • 283
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 3

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 3

... annealed for 15 inset is the typical Raman spectra of as-grown and Ge nanocrystals nanocrystals of annealing minutes The free standing As mentioned in Section 4 .3, Figures 4.8 and 4.11 show that, ... a tensile stress will result in an increase in the lattice spacing and, hence, a decrease in the wavenumber of the vibrational mode In the case of compressive stress, the decrease of the lattice ... annealing time was increased from 15 to 60 minutes As such, the nanocrystals would grow and increase in number as the annealing duration increases, which causes an increase in P shown in Figure 6.5...
  • 18
  • 227
  • 0
Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 5

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 5

... discussed in the following sections 8.4 Synthesis of Ge nanocrystals in U-shape groove In order to minimize the shadowing effect and make a relatively conformal film deposition, the KOH etching process ... bottom of the groove (i.e 70.6°) as comparing to the one of the corner of the mesa (i.e 144.7°) This difference in the arriving angle will inevitably cause the shadowing effect and results in the ... enhanced when the annealing temperature exceeds the melting point of Ge (i.e 937°C) By creating the U-shape groove substrate and hence increasing the Si/silicon oxide interfaces, one enables...
  • 14
  • 223
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics" doc

... nanocrystalline silicon embedded in SiO2 matrix Appl Phys Lett 1999, 75:1857-1859 Ding L, Chen TP, Liu Y, Ng CY, Fung S: Optical properties of silicon nanocrystals embedded in a SiO2 matrix Phys ... doi:10.1186/1556-276X-6-612 Cite this article as: Di et al.: Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics Nanoscale Research Letters ... larger grains A close-up view of region is shown in Figure 4a It is interesting to note that the intentionally doped Si NC films are more optically absorbing than the undoped material in this photon...
  • 6
  • 329
  • 0
Báo cáo nghiên cứu nông nghiệp

Báo cáo nghiên cứu nông nghiệp " Design and implementation and scientific and financial analysis of 12 Sunflower trials in Vietnam " pot

... crop season Sunflower was grown in the Autumn and compared to the financial benefit of maize in Di Linh district, Lam Dong province Crop Table 27 Economic analysis of sunflower, maize, in Autumn ... Study of the financial return of sunflower compared to maize and cotton in the South Central Coast of Viet Nam 2.3.1 Vegetative growth and development of sunflower hybrids Table 11 Yield and ancillary ... Profitability of sunflower production in Viet Nam March 2006 access unused nitrogen stored deep in the soil profile and benefit the following rice crop by reducing the incidence of pests, diseases and...
  • 21
  • 359
  • 0
báo cáo khoa học:

báo cáo khoa học: " Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes" docx

... stress and target genes were predicted for five of them For instance, vun_cand030 was downregulated by drought and putatively targets a zinc finger protein Zinc finger proteins are known to be involved ... breeding line developed by the International Institute of Tropical Page of 11 Agriculture (IITA) in Ibadan, Nigeria We grew these two genotypes in well-watered and drought stress conditions and ... identified in cowpea Detailed information of the predicted cowpea miRNAs and their targets Additional file 2: Predicted hairpin structures of nine genotypespecific miRNAs Predicted structures of nine...
  • 11
  • 391
  • 0
Báo cáo y học:

Báo cáo y học: " A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia" ppsx

... Cite this article as: Neelam et al.: A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia BMC Psychiatry 2011 11:139 Submit your next manuscript ... Janssen J, Diaz-Caneja A, Reig S, Bombin I, Mayoral M, Parellada M, Graell M, Moreno D, Zabala A, Vazquez VG, Desco M, Arango C: Brain morphology and neurological soft signs in adolescents with ... their siblings the result of perinatal trauma? Acta Psychiatrica Scandinavica 2000, 101:142-147 32 Orwin RG: A fail-safe N for effect size in meta-analysis Journal of Educational Statistics 1983,...
  • 8
  • 559
  • 0
báo cáo khoa học:

báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling of the labelling kinetics ... SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3 Proc Natl Acad Sci USA 2002, 99:8436-8441 Mahajan S, Pandey G, Tuteja N: Calcium and Salt Stress Signaling in Plants:...
  • 25
  • 292
  • 0
Báo cáo y học:

Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps

... expression analysis for diurnally regulated genes To gain insights into the tissue specificity of expression levels of diurnally regulated genes, we next examined their expression levels in the ... studies By identifying a large number of diurnally regulated genes in a defined brain region, a clustering analysis resulted in sufficiently large number of genes in each temporal category There ... R247 Yang et al R247.3 Figure A karyotype map showing the chromosome positions and frequencies of diurnally regulated genes in the mouse genome A karyotype map showing the chromosome positions and...
  • 15
  • 299
  • 0
Structural and functional analysis of critical proteins involved in mRNA decay

Structural and functional analysis of critical proteins involved in mRNA decay

... STRUCTURAL AND FUNCTIONAL ANALYSIS OF CRITICAL PROTEINS INVOLVED IN mRNA DECAY CHENG ZHIHONG (B.Sc) Ease China University of Science and Technology A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... deadenylation, decapping and degradation of the mRNA body Three proteins, hUpf1, Dhh1 and Ski8 involved in eukaryotic mRNA decay were structurally and functionally studied in this thesis Ski8 ... include the poly(A)-binding protein (Pab1) and the cap-binding protein (eIF4E) Pab1 couples decapping with deadenylation and inhibits decapping by promoting the formation of the translation initiation...
  • 191
  • 313
  • 0
báo cáo khoa học:

báo cáo khoa học: " Haplotyping, linkage mapping and expression analysis of barley genes regulated by terminal drought stress influencing seed quality" pot

... Cite this article as: Worch et al.: Haplotyping, linkage mapping and expression analysis of barley genes regulated by terminal drought stress influencing seed quality BMC Plant Biology 2011 11:1 ... 4d drought (M) Palea_ 4d drought (M) Awn_ 4d drought (M) Seed_ 4d drought (M) Seed 20DAF _drought (Brenda) Seed 20DAF _drought (Hs584) Seedling _drought (OWB-D) Seedling _drought_ OWB-R) 21day seedling_38%SWC ... growth under drought stress A -3.0 B Palea_ 4d drought (M) Awn_ 4d drought (M) Seed_ 4d drought (M) Seed 20DAF _drought (B) Seed 20DAF _drought (Hs) 1:1 21day seedling_19%SWC (M) 21day seedling_7%SWC...
  • 14
  • 425
  • 0
Static and Dynamic Analysis  of Space frames

Static and Dynamic Analysis of Space frames

... result list of load cases, superposition files and influence lines 3.64 Version 8.38.03 • • • • Use of combination codes “SupOrX” and “SupAndX” for superposition files corrected New command “PLSCFAC” ... to choose between E- and Fformat of the written values Information about units added to the plot file of the action PlInfl, screen plot Results/ PlInfl and to the list file of the action DoList/Influence ... new program release! 1.2 Unit dependency of Import/Export of RM2000 Export and Import of RM2000 database is now UNIT dependent! In this case: • • Import of PARTIAL project, created by RM2000 Version...
  • 19
  • 633
  • 0
Static and Dynamic Analysis  of Spaceframes

Static and Dynamic Analysis of Spaceframes

... Disclaimer and Copyright Disclaimer Much time and effort have gone into the development and documentation of RM2000 and GP2000 The programs have been thoroughly tested and used The user accepts and ... the two load sets and the two loading cases (e.g.: L.C is a UDL of 10kN/m from Elem to Elem 20 and L.C is a Settlement of 0.001m at the beginning of element 1200.) Choose AddCon and insert the ‘Additional ... the program and the documentation remain with TDV Austria Use of the program and the documentation is restricted to the licensed users Unlicensed use of the program or reproduction of the documentation...
  • 34
  • 1,125
  • 1

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI