0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Functional studies on nerve growth factor and its precursor from naja sputatrix

Báo cáo y học:

Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor and its receptor system in fibroblast-like ... proliferating FLSs produce proteinases that degrade cartilage and underlying cortical bone [4] We noticed that proinflammatory cytokines upregulate NGF/TrkA in FLSs, NGF/TrkA is upregulated in FLSs of in ammatory...
  • 2
  • 264
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" VEGF receptors on PC12 cells mediate transient activation of ERK1/2 and Akt: comparison of nerve growth factor and vascular endothelial growth factor" doc

... demonstrated that VEGF1 65 induced transient activation of ERK1/2 and Akt after In contrast, NGF produced a stronger and persistent phosphorylation of ERK1/2 and Akt than VEGF1 65 much more pronounced ... Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells Comparison of the effects of nerve growth factor and epidermal growth factor ... effect on PC12 cell proliferation and neurite formation One reason might be endogenous VEGF- expression of proliferating PC12 cells which is downregulated only 48 h after induction of differentiation...
  • 6
  • 275
  • 0
Báo cáo y học:

Báo cáo y học: "Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritsi" potx

... NGF expression by staining on a single cell level using flow cytometry Concomitant staining of cell surface markers and intracellular NGF revealed the presence of NGF in T lymphocytes (CD3+) and ... Figure NGF staining by flow cytometry PBMC of (a) healthy controls (HC) and (b) synovial fluid mononuclear cells (SFMC) from spondyloarthritis (SpA), cytometry and (c) rheumatoid arthritis (RA) ... various proinflammatory cytokines (data not shown) Taken together, these data suggest that infiltrating T lymphocytes and myeloid cells are the main source of NGF in the inflamed peripheral joint Discussion...
  • 9
  • 349
  • 0
Báo cáo y học:

Báo cáo y học: " Increased expression of matrix metalloproteinase-10, nerve growth factor and substance P in the painful degenerate intervertebral disc" pot

... of PC-12 cells strongly induces MMP-10 gene expression We have previously identified the expression of the neurotrophin NGF and the pain-associated neuropeptide substance P in the human IVD and ... to increased nociception in painful IVD degeneration Page of (page number not for citation purposes) The aim of the current study was to examine the gene and protein expression of MMP-10 in histologically ... of NGF expression The increased expression of MMP-10 may therefore result in increased matrix degradation directly and through 'super-activation' of other MMPs already shown to be increased in...
  • 8
  • 673
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 553
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Angiogenesis effects of nerve growth factor (NGF) on rat corneas" docx

... postoperative day to day Vessels were first noted on postoperative day As progressed, the Angiogenesis effects of nerve growth factor (NGF) on rat corneas 129 Fig Appearance of angiogenesis on day ... 1.0 ng of NGF group (Group 1.0), and the 5.0 ng of NGF group (Group 5.0) Data analysis The significant differences between groups were Angiogenesis effects of nerve growth factor (NGF) on rat corneas ... w/v) at 37oC with continuous stirring for 24 hours An equal volume of Hydron and sucralfate (12% w/v, Sigma Co, USA) were combined Also each concentration of nerve growth factor (NGF), such as 0.5...
  • 6
  • 361
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Immunohistochemical Localization of Nerve Growth Factor,Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil" ppsx

... Immunohistochemical Localization of Nerve Growth Factor, Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil ... Immunohistochemical Localization of Nerve Growth Factor, Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil 241 ... were observed in the white matter of the spinal cord at PNW (Fig 1I) Fig NGF-IR neurons were found in the mesencephalon, rhombencephanlon and spinal cord of the developing brain NGF-IR initiated...
  • 7
  • 313
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "In vitro and in vivo gene therapy with CMV vector-mediated presumed dog b-nerve growth factor in pyridoxine-induced neuropathy dogs" pot

... Mata M, Fink DJ In vivo gene therapy for pyridoxine-induced neuropathy by herpes simplex virus-mediated Presumed dog β-NGF gene therapy in vitro and in vivo 373 gene transfer of neurotrophin-3 Ann ... determine the effect of the cytomegalovirus (CMV) vector-mediated gene transfer of the pdβ-NGF in vitro and gene therapy using recombinant pdβ-NGF plasmid in the dog model, having pyridoxine-induced ... lesions in the lateral, dorsal or ventral funiculus, or in the gray matter of L4 in the negative control group (Fig 3A) The axons and myelin was Presumed dog β-NGF gene therapy in vitro and in vivo...
  • 7
  • 276
  • 0
Báo cáo y học:

Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx

... including hypoxic conditions and stimulation by transforming growth factor, CD40 ligand, interleukin 1, or interleukin [10] Oxidative stress also promotes angiogenesis [13] The link between oxidative ... diffusible proteins from mature, monomeric VEGF), but not human placenta-derived growth factor, platelet-derived growth factor, or transforming growth factor Inter- and intra-assay variances for VEGF, ... concentrations residue and vascular endothelial growth Correlation between carbonyl in systemic sclerosis patients at baseline factor (VEGF) concentrations in systemic sclerosis patients at baseline (n = 40;...
  • 6
  • 518
  • 0
Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

... FUNCTIONAL STUDIES ON SULPHATION STATUS OF HEPARAN SULPHATE IN BREAST NON- TUMOURIGENIC EPITHELIAL AND CANCER CELLS GUO CHUNHUA (B.Med., M.Med.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Undersulphation of GAGs inhibited invasion of breast cancer cell in vitro 120 Discussion 123 HSPG and breast cancer growth 123 HSPG and adhesion, migration and invasion in ... Reduction in heparan sulphation in breast cancer cells was demonstrated to inhibit breast cancer cell proliferation The inhibitory effect could be rescued by addition of porcine intestine mucosa-derived...
  • 289
  • 366
  • 0
Structural and functional studies on type III and type VI secretion system proteins

Structural and functional studies on type III and type VI secretion system proteins

... I Secretion System 1.6 Type II Secretion System 10 1.7 Type III Secretion System 12 1.8 Type IV Secretion System 26 1.9 Type V Secretion System 27 1.10 Type VI Secretion System 29 1.11 Aim of ... Island Figure: Type I–V secretion systems in Gram-negative bacteria Figure: 1.3 Model of pilus-mediated secretion via the type II secretion system 11 Figure: 1.4 The Type Three Secretion System ... abbreviations xvi Publications xx Chapter 1: General Introduction 1.1 Host Pathogen Interaction 1.2 Pathogenicity islands 1.3 Protein Secretion System 1.4 Sec system 1.5 Type I Secretion System...
  • 169
  • 356
  • 0
Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx

Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx

... regulation of the epidermal growth factor receptor by protein kinase C J Biol Chem 2 71, 12 8 91 12 896 51 El-Shemerly, M.Y., Besser, D., Nagasawa, M & Nagamine, Y (19 97) 12 -O-Tetradecanoylphorbol -13 -acetate ... of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor Cell 73, 611620 12 Schlessinger, J (19 93) How receptor tyrosine kinases activate Ras Trends Biochem Sci 18 , 27 3 27 5 13 Pawson, ... the epidermal growth factor receptor J Biol Chem 27 4, 3 016 9–3 018 1 3 9 12 J J Hornberg et al (Eur J Biochem 2 71) Bhalla, U.S & Iyengar, R (19 99) Emergent properties of networks of biological signalling...
  • 9
  • 541
  • 0
Báo cáo khóa học: Nerve growth factor mediates activation of the Smad pathway in PC12 cells doc

Báo cáo khóa học: Nerve growth factor mediates activation of the Smad pathway in PC12 cells doc

... activation of the Smad pathway independently of the TGF-b ligand Fig PC12 cells express low levels of endogenous TbRII (A) C-terminal phosphorylation of Smad2 was investigated in either parental PC12 cells ... Smad activation occurs independently from phosphorylation at the C-terminal SSXS-motif Involvement of Smad4 in NGF-triggered activation of the Smad signaling cascade In TGF-b1-induced signaling, ... signaling, R-Smads form heteromeric complexes with Smad4 following the activation by TbRI Fig Role of Smad4 in NGF-triggered activation of the Smad pathway (A) The role of functional Smad4 was investigated...
  • 12
  • 539
  • 0
Báo cáo khoa học: Tetranectin binds hepatocyte growth factor and tissue-type plasminogen activator potx

Báo cáo khoa học: Tetranectin binds hepatocyte growth factor and tissue-type plasminogen activator potx

... of hepatocyte growth factor activator by thrombin J Biol Chem 268, 2292722932 Mars, W.M., Zarnegar, R & Michalopoulos, G.K (1993) Activation of hepatocyte growth factor by the plasminogen activators ... activators uPA and tPA Am J Pathol 143, 949958 Thewke, D.P & Seeds, N.W (1996) Expression of hepatocyte growth factor/ scatter factor, its receptor, c-met, and tissue-type plasminogen activator during ... plasminogen- like growth factors HGF and MSP are very similar to Plg in their domain structure and each of them contains four kringle domains Prothrombin has two kringle domains and the structures of plasminogen...
  • 5
  • 410
  • 1

Xem thêm

Từ khóa: transforming growth factorβ and smadsan english vietnamese cross cultural communication study on using addressing form and its potential culture shock 3 4 dhp treatment and immunomodulation by jim11 antibody on the growth development and regeneration of somatic embryosforeign direct investment in vietnam and its impact on economic growthpressure and its effect on the rate and amount of microbial growthforms of investments and elaborate on the risk factordifferent forms of investment opportunities and elaborate on the risk factorleast six possible forms of investments and elaborate on the risk factorsix possible forms of investments and elaborate on the risk factorsix forms of investments and elaborate on the risk factorinformation retrieval on the web and its evaluationhistory of the indian caste system and its impact on india todayoxidative stress and transforming growth factorβ1induced cardiac fibrosisreview ten empirical studies on the impact of inflation on economic growth in nigeriaimpact of inflation and unemployment on economic growth in nigeriaBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ