Distributed data reconciliation and bias estimation with non gaussian noise for sensor network
Distributed data reconciliation and bias estimation with non gaussian noise for sensor network
... y2 and y3 78 Table 5.1: Bias estimation results for data without outliers 99 Table 5.2: Bias estimation results for data with 25% outliers times larger than original data 99 Table 5.3: Bias estimation ... CHAPTER DISTRIBUTED BIAS ESTIMATION (DBE) 61 4.1 INTRODUCTION 61 4.2 BIAS ESTIMATION 63 4.2.1 Least squares (LS) bias estimation 64 4.2.2 GT-based bias estimation ... compensate for the lower quality of the low-cost sensors A straightforward way to perform DR in sensor networks is to download the measurements from all sensor nodes in the network, and then have...
- 126
- 235
- 0
Framework for joint data reconciliation and parameter estimation
... estimator for a joint data reconciliation – parameter estimation strategy is formulated The algorithm consists of three main steps: the preliminary estimation and the estimation of the GT parameters ... steps corresponding to data reconciliation and parameter estimation are merged into a single joint data reconciliation – parameter estimation (DRPE) step 11 The problem formulation, taking the weighted ... simulation cases A comprehensive literature review of the data reconciliation and joint data reconciliation – parameter estimation, and the technical aspects associated with them is conducted...
- 104
- 212
- 0
Design and analysis of object replacement policies on dynamic data allocation and replication algorithm with buffer constraints
... of data allocation and replication, a data allocation and replication algorithm solves three fundamental questions: Which object should be replicated? How Chapter Introduction many replicas of ... Chapter Data Allocation and Replication with Finite-size Buffer Constraints 35 Thus, an extra cost of control-message is needed to inform the CCU of the change of the allocation scheme of the object ... Competitive analysis thus falls within the framework of worst-case complexity 4.1.1 Offline and online dynamic data allocation algorithms We begin with a discussion of the concept of an offline dynamic data...
- 104
- 316
- 0
Báo cáo khoa học: "Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting Relations" pptx
... 2 Maximum Entropy models for extracting relations We built Maximum Entropy models for predicting the type of relation (if any) between every pair of mentions within each sentence ... final ranking and the results of other participants Discussion We have presented a statistical approach for extracting relations where we combine diverse lexical, syntactic, and semantic features ... Table 4: The F-measure and ACE Value for the test sets with true (T) and system output (S) mentions and entities high precision Adding the parse tree and dependency tree based features gives us our...
- 4
- 293
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR ... cycle and OXPHOS pathways along with a series of degradation pathways of carbohydrates, fatty acids, and amino acids, articulating with the TCA cycle by furnishing substrates Interestingly, this...
- 21
- 376
- 0
Báo cáo y học: "Morning and evening behavior in children and adolescents treated with atomoxetine once daily for Attention-Deficit/Hyperactivity Disorder (ADHD): Findings from two 24-week, open-label studie" potx
... well-being in children and adolescents treated with atomoxetine for attention-deficit/hyperactivity disorder: Findings from a patient, parent and physician perspective Child Adolesc Psychiatry Mental ... Difficulty playing quietly in the afternoon /evening Inattentive and distractable in the afternoon /evening Difficulty transitioning Arguing or struggling in the afternoon /evening Difficulty settling ... Cheng JYW, Chen RYL, Ko JSN, Ng EML: Efficacy and safety of atomoxetine for attention-deficit/hyperactivity disorder in children and adolescents Meta-analysis and meta-regression analysis Psychopharmacology...
- 10
- 475
- 0
Local domain free discretization method and its combination with immersed boundary method for simulation of fluid flows
... LOCAL DOMAIN- FREE DISCRETIZATION METHOD AND ITS COMBINATION WITH IMMERSED BOUNDARY METHOD FOR SIMULATION OF FLUID FLOWS WU YANLING (B.Eng,NUAA, M.Eng, NUS) A THESIS SUBMITTED FOR THE DEGREE OF ... LDFD method to flexibly handle flow problems with complex geometry LDFD-IBM is a delicate combination of LDFD method and Immersed Boundary Method (IBM), and enjoys the merits of both methods For ... non-conforming-mesh methods, Local Domain- Free Discretization (LDFD) method and hybrid LDFD and Immersed Boundary Method (LDFD-IBM), are proposed to solve this problem The concept of LDFD method is based...
- 250
- 567
- 0
On multi zone tracking and non gaussian noise filtering for model predictive control
... gains for zone and zone outputs are 100 times smaller than the gains for zone output This shows that for SMPC the outputs of zone and zone contribute little to the zone control signal, only the ... submitted for any degree in any university previously WANG XIAOQIONG 30 Mar 2014 ON MULTIZONE TRACKING AND NON- GAUSSIAN NOISE FILTERING FOR THE MODEL PREDICTIVE CONTROL Copyright 2014 by WANG XIAOQIONG ... of zone is important to the zone control signal While UMPC tells a different story, the gain for zone and zone output are comparable to 38 the gain for zone output For UMPC the outputs of zone and...
- 154
- 423
- 0
Electrospun titanium dioxide nanostructures and their composites with carbon rich materials for energy conversion and storage
... ELECTROSPUN TITANIUM DIOXIDE NANOSTRUCTURES AND THEIR COMPOSITES WITH CARBON RICH MATERIALS FOR ENERGY CONVERSION AND STORAGE ZHU PEINING (B Eng., Huazhong University of Science and Technology) ... electrical devices Therefore, the topic of renewable energy comes with the dual topic of energy conversion and storage There are mainly two kinds of batteries for energy storage The first kind ... DSCs and LIBs[14, 15] Recently, TiO2 with carbon rich materials (carbon nanotube, graphene, etc) nanocomposites was studied for their enhanced properties compared to pure TiO2 [16-26] The carbon...
- 229
- 280
- 0
Báo cáo hóa học: " Research Article Reiterative Robust Adaptive Thresholding for Nonhomogeneity Detection in Non-Gaussian Noise" pot
... τi xi , √ H1 : zi = pi + τi xi (6) Bearing in mind that we are concerned with training data containing interfering targets, which share the same steering vector as that of the desired target, ... situation of multiple outliers in the secondary data is depicted in Figure 13, in addition to the interfering target in Pc , another interfering one with the same INR A Younsi et al 1.2 0.9 0.8 ... the set threshold inaccurate for practical use This paper presents a data-dependent adaptive thresholding algorithm that can be used for nonhomogeneity detection in compound-Gaussian noise The...
- 11
- 439
- 0
Báo cáo hóa học: " Dynamic Agent Classification and Tracking Using an Ad Hoc Mobile Acoustic Sensor Network" ppt
... and N R Sandell Jr, “Detection with distributed sensors,” IEEE Trans on Aerospace and Electronics Systems, vol 17, pp 501–510, July 1981 [3] R Brooks, C Griffin, and D S Friedlander, “Self-organized ... networks can coordinate platforms around tracks and provide relevant processing with a minimum of bandwidth and power consumption related to interplatform communications This procedure is scalable and ... Optics and Photonics News, vol 2, no 8, pp 24–30, 1991 [6] M Hellebrant, R Mathar, and M Scheibenbogen, “Estimating position and velocity of mobiles in a cellular radio network,” IEEE Trans Vehicular...
- 7
- 192
- 0
Interference minimized multipath routing with congestion control in wireless sensor network for multimedia streaming
... not hold true for wireless networks due to route coupling 3.3 Wireless Network Multipath load balancing in a single-channel wireless network is not as straightforward as in a wired network This ... WSN with high-capacity UAV backbone network support for multimedia streaming, however multipath routing is not used Much research has been done on multipath 17 routing for multi-hop and single-channel ... cast effects of wireless interferences, it will be used to model wireless interferences when analyzing the problem of multipath load balancing in a single channel wireless network for this thesis...
- 101
- 252
- 0
Báo cáo khoa học: "Hierarchical Joint Learning: Improving Joint Parsing and Named Entity Recognition with Non-Jointly Labeled Data" potx
... likelihood and partial derivatives See (Finkel et al., 2008) for details 4.3 Joint Model of Parsing and Named Entity Recognition Our base joint model for parsing and named entity recognition ... hierarchical joint model to parsing and named entity recognition, and it reduced errors by over 20% on both tasks when compared to a joint model trained on only the jointly annotated data them Ando and ... example of a sentence jointly annotated with parse and named entity information Named entities correspond to nodes in the tree, and the parse label is augmented with the named entity information...
- 9
- 336
- 0
Báo cáo hóa học: " Research Article Distributed Space-Time Block Coded Transmission with Imperfect Channel Estimation: Achievable Rate and Power Allocation" pot
... constrained to P, and it is assumed that the transmitters cooperate to provide a distributed spacetime block encoder, and that the channel coefficients remain constant during the transmission of a space-time ... D-STBCs, SIMO subchannels, and distributed MIMO channel with two receive antennas, versus the channel estimation error variance of the first subchannel, that is, σ1 , at SNR = 20 dB The channel estimation ... effect of channel knowledge uncertainty at the receiver on the mutual information of distributed space-time block coded transmission in Rayleigh fading channels Specifically, we studied upper and lower...
- 9
- 257
- 0
Từ khóa: adc and eadc estimation with two and multiple b valuesdeconvolution and lti systems with no measurement noisedynamic and non linear programming for looped networksrouting and wavelength assignment with multi granularity traffic in optical networksand the percentage with varying population frequencies for the 1291 autosomal cnpssimultaneous saccharification and co fermentation with high solid loading for lignocellulosic bioethanol productiondata structures and algorithms with objectoriented design patterns in c pdfdata structures and algorithms with javascriptdefine data and information explain with examplesdata information and knowledge with examplesdifference between data information and knowledge with examplesdefine data information and knowledge with exampledata structures and algorithms with javascript ebookdata structures and algorithms with javascript amazondata structures and algorithms with javascript free pdfBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ