Proline rich acidic protein 1 in life and death 2

...

... 76 3 .1 PRAP1 and intestinal differentiation 3 .1. 1 PRAP1 is expressed in epithelial cells of the intestines The expression of PRAP1 in human intestinal tract was studied using immunohistochemistry ... 77 Figure 3 .11 PRAP1 is expressed in the epithelial cells of small intestine Representative figure showing PRAP1 immunohistochemical staining in normal human small intestine tissue (X100 magnification) ... treatment, and further increased to 5-fold at 72 hours (Figure 3 .18 -B) These data indicate that induction of PRAP1 occurred by an increase of PRAP1 mRNA  83 Figure 3 .17 PRAP1 expression is induced...

... (p53-/-) and one with p 21 knockout (p 21- /-) PRAP1 mRNA was induced in both HCT 11 6 wild-type and p 21- /- cell lines, but not in p53-/- 10 6 Figure 3.37 Early upregulation of PRAP1 in a dose- and time-dependent ... 5-FU induced an increase in cyclin E1 and cyclin A1 protein levels, reflecting an arrest at S-phase (Figure 3.55) Repression of PRAP1 induction by 5FU caused a significant reduction in cyclin A1 ... function of p 21 in causing cell cycle arrest These 12 5 Figure 3.55 Repression of PRAP1 expression reduces cyclin A1 Representative western blot of cyclin E1, cyclin A1, p53 and B-ACTIN in HCT 11 6 cells...

... Identification of PRAP1 binding protein by MS-MS Representative figure showing the identification of PRAP1 binding proteins after performing MS-MS Figure 3. 71 PRAP1 physically interacts with Hsp ... F-actin in HCT 11 6 cells stably expressing PRAP1 (PRAP1) and its empty vector control stable cell line (Vector), or after transfection of control siRNA and PRAP1 siRNA for 72 hours F-actin was ... was stained using Palloidine conjugated to FITC (Green) and nuclear was counter stained with Hoechst (Blue) 14 1 3 .11 .1. 3 Effects of PRAP1 on microtubules To further study the effect of PRAP1 on...

... DISCUSSION 17 3 4 .1 Role of PRAP1 in differentiated epithelial cells 4 .1. 1 Regulation of PRAP1 by differentiation 4 .1. 1 .1 Expression of PRAP1 in intestinal epithelium The proline- rich acidic protein (PRAP1) ... floating cells, we employed the annexin V-FITC staining assay Annexin V is a phospholipid binding protein that has a high binding affinity for phosphatidylserine (PS) that translocates from inner ... potent in inducing PRAP1 expression in U937, THP -1 and Jurkat (Figure 3.90) We failed to detect any significant induction of PRAP1 by 5-FU in HL-60 cells PRAP1 expression was also induced by CPT and...

... detection of cellular retinoic acid binding proteins I and 3570 R.-Z Liu et al 15 16 17 18 19 20 21 22 23 24 25 26 27 28 II with new antibodies J Histochem Cytochem 46, 11 03 11 11 Zetterstrom RH, Lindqvist ... (19 90) Retinoic acid receptors and cellular retinoid binding proteins I A systematic study of their differential pattern of transcription during mouse organogenesis Development 11 0, 11 33 13 51 ... crabp1 gene symbols are in bold Another pair of duplicated genes (foxb1 .1 and foxb1.2) on zebrafish LG and LG 25 and the human FOXB1 ortholog on chromosome 15 are underlined The order of the human...

... Janus kinase ⁄ signal transducer and activator of transcription signaling pathway mediate the regulation of systemic and tissue localized renin -angiotensin system Mol Endocrinol 18 , 10 33 10 41 11 Xu ... studies indicate that transcription activation by STATs requires activated AP -1 [11 13 ] AP -1 is a complex composed of the Fos and Jun proteins [14 16 ] In general, Fos and Jun family proteins function ... role of angiotensinogen Endocr Rev 18 , 662–677 Mascareno E, Dhar M & Siddiqui MA (19 98) Signal transduction and activator of transcription (STAT) protein- dependent activation of angiotensinogen...

... Colosia AD, Donahue JP, Lin YZ, Hawiger J: Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylate the amino acids serine-63 ... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense...

... Content of osteogenic protein protein in synovial fluid samples The samples osteogenic protein (OP -1) content of synovial fluid from asymptomatic donors (donor) and from osteoarthritis (OA) and rheumatoid ... therefore not surprising and may have a prognostic and /or diagnostic value for the inflammatory processes in articular joints a prior history of joint disease, the majority of these joints displayed ... aspirated within 24 hours of death from the knee joints of 14 asymptomatic human organ donors with no documented history of joint diseases This study, performed with assistance from the Gift of Hope Organ...

... .14 1. 1.2.3 Radiation 18 1. 1.3 Mechanisms for preventing genomic instability 20 1. 1.3 .1 Poly (ADP- ribose) polymerase (PARP -1) 21 1 .1. 3 .1. 1 Role of PARP -1 at the telomeres 24 1. 1.4 ... 1. 1.4 Copper metabolism and disease 27 1. 1.4 .1 PARP -1 and Copper metabolism .29 1. 1.5 1. 2 1. 3 1. 4 Genomic Instability 1. 1 .1. 1 Telomere mediated genomic instability .2 1. 1 .1. 1 .1 ... 1. 1 .1. 1 .1 Telomeres 1. 1 .1. 1.2 Telomere dysfunction and tumourigenesis 1. 1 .1. 1.3 DNA repair proteins in telomere maintenance .8 Copper chaperone, Antioxidant protein (ATOX1) 31 Rationale...

... 3 .1 Mia1p in assembly and maintenance of persisent iMTOCs at nuclear envelope 44 3 .1. 1 Lack of microtubule binding protein Mia1p results in fewer interphase Microtubules 44 3 .1. 1 .1 Mia1p is a microtubule ... cytoskeleton 18 18 1. 2.4 .1. 1 Architecture and dynamics of interphase microtubule cytoskeleton 18 1. 2.4 .1. 2 Functions of interphase microtubule cytoskeleton 19 1. 2.4 .1. 2 .1 Maintaining cell morphology 19 1. 2.4 .1. 2.2 ... between Mia1p and Alp14p 10 9 4.5 .1 Mia1p interacts with Alp14p but not Dis1p 10 9 4.5.2 Different aspect of Mia1p and Alp14p functions in microtubule x attachment to the NE 11 0 4.5.3 Lack of Mia1p and...

... degradation of IGFBP-1 isoforms The y-axis shows the percentage of the ratio between the spot area of the degraded and that of the untreated protein measured using IMAGE J 1.37V software the presence of ... almost to the same extent as the unmodified protein and that the susceptibility to proteolytic degradation of the isoforms increased with the number of phosphates linked to the polypeptide chains The ... elevation of insulin-like growth factor (IGF) binding protein-1 decreases plasma free IGF-I and muscle protein synthesis Endocrinology 144, 3922–3933 Westwood M (1999) Role of insulin-like growth factor...

... I 13 98 + 14 62 11 22 13 05 10 13 + 13 98 13 05 11 22 13 98 14 62 14 62 10 13 11 22 13 05 13 98 14 62 + 14 62 13 98 11 22 11 22 10 13 13 05 62 13 98 14 62 13 05 13 98 11 22 13 05 62 13 98 13 05 III 11 22 10 13 IV AD1 ? ? Repression ... FEBS 217 9 Autoregulation of GRIP1 functions via C-terminal region P.-Y Liu et al 11 22 13 05 10 13 13 98 14 62 11 22 13 05 10 13 11 22 10 13 + 13 98 13 05 13 98 14 62 14 62 14 62 13 98 11 22 10 13 II 13 05 11 22 13 05 ... GST 11 22 -13 04 13 05 -13 98 13 05 -14 62 10 13 99 -14 62 11 22 -14 62 GST-GRIP1 GST GST-GRIP1 Input 10 % B GRIP1 11 22 -14 62 GST-GRIP 113 05 -13 98 GRIP1 GST Input 10 % C 14 62 765 563 11 21 112 2 14 62 Fig GRIP1 forms...