Role of poly (ADP ribose) polymerase 1 and copper homeostasis factor, antioxidant protein 1 in the maintenance of genomic integrity

... .14 1. 1.2.3 Radiation 18 1. 1.3 Mechanisms for preventing genomic instability 20 1. 1.3 .1 Poly (ADP- ribose) polymerase (PARP -1) 21 1 .1. 3 .1. 1 Role of PARP -1 at the telomeres 24 1. 1.4 ... 1. 1.4 Copper metabolism and disease 27 1. 1.4 .1 PARP -1 and Copper metabolism .29 1. 1.5 1. 2 1. 3 1. 4 Genomic Instability 1. 1 .1. 1 Telomere mediated genomic instability .2 1. 1 .1. 1 .1 ... 1. 1 .1. 1 .1 Telomeres 1. 1 .1. 1.2 Telomere dysfunction and tumourigenesis 1. 1 .1. 1.3 DNA repair proteins in telomere maintenance .8 Copper chaperone, Antioxidant protein (ATOX1) 31 Rationale...

204
1,390
0

Báo cáo khoa học: Poly(ADP-ribose) polymerase-1 protects excessive DNA strand breaks from deterioration during repair in human cell extracts pot

... prevents excessive SSBs arising during BER or as a result of direct DNA damage Results Cross-linking of BER proteins during repair of damaged DNA Although it has previously been shown that PARP-1 binds ... for binding of XRCC1 and Polb to damaged DNA C Fig Involvement of PARP-1 in BER in human cell extracts (A) A uracil-containing (left panel), or the corresponding control (right panel) biotinylated ... PARP-1 binding may protect DNA strand breaks from nuclease attack when BER enzymes are a limiting factor in repair [24] To test this hypothesis, we compared PARP-1 involvement in the repair of...

báo cáo hóa học: " Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b" pot

... comparisons (Table 3) PARP-1 modulates microglial trophic factor release Activated microglia can also release, in addition to neurotoxic agents, several cytokines and trophic factors that PARP-1 inhibition ... article as: Kauppinen et al.: Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b Journal of Neuroinflammation 2011 8:152 Submit your next manuscript to BioMed Central and take ... which is a potent PARP inhibitor [62], likewise does not block Ab phagocytosis by microglia [63,64] Conclusions The present study is, to our knowledge, the first to evaluate the therapeutic potential...

Báo cáo y học: "Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line" pptx

... that the heat shock response is negatively modulated by PARP-1 activation in fibroblasts; therefore siRNA mediated PARP-1 inhibition would lead to augmentation of the heat shock response Material ... H, Salzman AL, Szabo C: Peroxynitritemediated DNA strand breakage activates poly- adenosine diphosphate ribosyl synthetase and causes cellular energy depletion in macrophages stimulated with bacterial ... poly( ADP-ribose) polymerase inhibitors Pharmacol Rev 2002, 54:375-429 Mota RA, Hernandez-Espinosa D, Galbis-Martinez L, et al: Poly( ADP-ribose) polymerase-1 inhibition increases expression of heat shock...

Báo cáo y học: " Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line." pptx

Báo cáo khoa học: Effect of oxidative stress and involvement of poly(ADP-ribose) polymerase (PARP) in Dictyostelium discoideum development doc

... fruits PARP involvement during oxidative stress- induced developmental changes in D discoideum To determine the role of PARP in oxidative stressinduced developmental changes, D discoideum cells were ... Rajawat et al PARP in Dictyostelium discoideum development 20 microns Fig Effect of PARP inhibition during oxidative stress- induced developmental changes in D discoideum Cells were preincubated with ... the role of PARP in D discoideum development by inhibiting its activity with the known PARP inhibitor benzamide, and studied its effects on development and oxidative stressinduced development Our...

Báo cáo y học: "Inflammatory and transcriptional roles of poly (ADP-ribose) polymerase in ventilator-induced lung injury" doc

... Histopathologic findings and acute lung injury (ALI) scores The ventilator-induced lung injury (VILI) group (c) showed typical findings of lung injury, scores such as intra-alveolar exudates, hyaline membrane ... pathophysiology of ventilator-induced lung injury (VILI) are necessary In the VILI model of normal mice lung, injurious mechanical ventilation strategy overactivated poly (ADP-ribose) polymerase (PARP), ... pathogenesis of VILI PARP is a protein-modifying and nucleotide-polymerizing enzyme that is abundant in the nucleus and involves in DNA repair resulting from genotoxic stress by poly (ADP-ribosyl)ation...

Báo cáo y học: " The role of poly (ADP-ribose) polymerase in ventilator-induced lung injury" ppsx

... Kim HY, Jung KH, Kang EH, Lee SY, Suh IB, Shin C, Shim JJ, In KH, Yoo SH, Kang KH: Inflammatory and transcriptional roles of poly (ADP-ribose) polymerase in ventilator-induced lung injury Crit ... be clinically relevant, is frequently necessary to induce appropriate lung injury Competing interests The authors declare that they have no competing interests References Kim JH, Suk MH, Yoon ... ventilation in healthy mice induces reversible pulmonary and systemic cytokine elevation with preserved alveolar integrity: an in vivo model using clinical relevant ventilation settings Anesthesiology...

Tài liệu Báo cáo khoa học: Poly(ADP-ribose) The most elaborate metabolite of NAD+ Alexander Burkle pptx

... below) within the known members of the PARP family Adjacent to the ANK domain is another protein interaction motif, the sterile alphamodule The C-terminus of tankyrase displays homology to the PARP-1 ... variants of the human PARG have been described, giving rise to PARG isoforms targeted either to the nucleus or to the cytoplasm [47] Overexpression studies revealed that the largest isoform of PARG ... developed over the last couple of years are (a) the localized relaxation of chromatin at the site of DNA damage, mediated either by direct modiﬁcation of histones or noncovalent interaction of histones...

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... Colosia AD, Donahue JP, Lin YZ, Hawiger J: Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylate the amino acids serine-63 ... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense...

Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation

... over-expression of p21WAF1 inhibits DNMT1 73 3 .1. 1.7 TSA -mediated induction of p21WAF1 results in inhibition of 76 DNMT1 3 .1. 1.8 TSA -mediated induction of p21WAF1 is independent of p53 85 3 .1. 2 Transcriptional ... between DNMT1 and p21WAF1 in the 63 cell cycle 3 .1. 1 .1 3 .1. 1.2 DNMT1 expression in the cell cycle 63 WAF1 in DNA 67 p21WAF1 68 Transient over-expression of DNMT1 does not inhibit 71 Inverse relationship ... methylase 17 1. 3.3b DNMT1 interacts with Polycomb Group (PcG) proteins 17 1. 3.3c DNMT1 interacts with UHRF1 18 Transcriptional suppression 19 1. 3.4 iv 1. 4 DNMT1 in the Cell Cycle 1. 4 .1 21 1.4.2 E2F1/RB...

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... requires protein translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general ... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... constitute the minimal transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain...

Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

... and PAI-1 on the rate of thrombin/ PAI-1 complex formation For various combinations of kon and koﬀ for the thrombin/ TM interaction, the concentration of all reactants and intermediates was calculated ... PAI-1 The rate of thrombin inhibition by 1.5 lM PAI-1 was measured in the presence of increasing concentrations (0–800 nM) of solulin Solulin lacks the transmembrane domain and does not contain ... constructed and analyzed as described [6] The effect of increasing concentrations of solulin on the inhibition of thrombin and thrombin- VR1tPA by PAI-1 was determined To that end, a solution of...

Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx

... that the F-11 cells not only express the rat VRL-1, but also the mouse VRL-1 and that the mouse variant is derived from the F-11 parental cell line N18TG2 This ﬁnding is of interest when VRL-1 ... A, B and D of F-11 cells again separated into two bands The slower migrating band always corresponded to the rat brain control, and the faster migrating band to the N18TG2 control (Fig 5) The ... characteristics of the capsaicin sensitive Vanilloid receptor VR1 transiently transfected in the rat dorsal root ganglia derived cell line F-11, a hybridoma of mouse neuroblastoma and rat dorsal root ganglion...

Xem thêm