A green supply chain network design model for enhancing competitiveness and sustainability of companies in high north arctic regions
A green supply chain network design model for enhancing competitiveness and sustainability of companies in high north arctic regions
... domestic and international suppliers, and it mainly serves local customers In order to design and maintain an efficient and sustainable supply chain with relatively low risks, the supply chain manager ... literature analysis of definitions for green and sustainable supply chain management Journal of Cleaner Production 2013, 52, 329-341 [7] Stivastava, S.K Green supply- chain management: a state -of- the art ... so as to minimize the supply chain risks The mathematical model is formulated and developed under certain input parameters, however, the design and planning of supply chain network is always a...
- 16
- 340
- 0
Every Woman Matters: A Report on Accessing Primary Health Care for Black Women and Women of Colour in Ontario pptx
... Every Woman Matters A Report on Accessing Primary Health Care for Black Women and Women of Colour in Ontario Toronto, August 2010 Report preparation Charmaine C Williams Notisha Massaquoi ... accessible health care model fig Primary Health Care Logic Model To increase access to primary health care for Black Women and Women of Colour in Toronto and surrounding areas by developing and implementing a more efficient model of care ... healthcare for Black Women and Women of Colour Individual and systemic experiences of racism can have a pervasive and devastating impact on population health and well-being (Ali & Massaquoi,...
- 90
- 502
- 0
Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf
... Dong Yang, Paul Dixon, Yi-Cheng Pan, Tasuku Oonishi, Masanobu Nakamura and Sadaoki Furui 2009 Combining a Two-step Conditional Random Field Model and a Joint Source Channel Model for Machine Transliteration, ... Lafferty, Andrew McCallum, and Fernando Pereira 2001 Conditional Random Fields: Probabilistic Models for Segmenting and Labeling Sequence Data., Proceedings of International Conference on Machine ... Kumar Naskar and Sivaji Bandyopadhyay 2006 A modified joint source-channel model for transliteration, Proceedings of the COLING/ACL, pages 191-198 Bo-June Hsu and James Glass 2008 Iterative Language...
- 6
- 419
- 0
Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc
... global joint model for morphological analysis The idea of this model is to jointly predict the set of possible tags and lemmas of words In addition to modeling dependencies between the tags and ... bouncer and bounce will detect a problem with this assignments and will be able to correct the tagging and lemmatization error for bouncer The main source of information our joint model uses is information ... Czech Czech Czech lemmatization subtasks, which a joint model could exploit 6.3 Evaluation of joint models Since our joint model re-ranks candidates produced by the component tagger and lemmatizer,...
- 9
- 430
- 0
Báo cáo khoa học: " Establishment of one-step SYBR green-based real time-PCR assay for rapid detection and quantification of chikungunya virus infection" pps
... doi:10.1186/1743-422X-7-13 Cite this article as: Ho et al.: Establishment of one-step SYBR greenbased real time-PCR assay for rapid detection and quantification of chikungunya virus infection Virology Journal 2010 ... Page of Figure One-step SYBR green-based RT-PCR for detection of CHIKV infection (A) Amplification profile and (B) the standard curve generated from the amplification profile of the one-step SYBR ... G: Molecular diagnosis and analysis of Chikungunya virus J Clin Virol 2007, 39(4):271-275 11 Parida MM: Rapid and real- time detection technologies for emerging viruses of biomedical importance...
- 7
- 262
- 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... user-friendly character of the yrGATE system contributes to its accessibility and to its potential for community adoption Annotation tool The Annotation Tool of the yrGATE package is a web-based utility...
- 11
- 467
- 0
Báo cáo y học: " Reduced peak oxygen uptake and implications for cardiovascular health and quality of life in patients with schizophrenia" ppsx
... factors for CVD and evaluation of VO 2peak should be incorporated in clinical practice Finally, these finding represent an urging need for developing effective physical training interventions for patients ... Reduced peak oxygen uptake and implications for cardiovascular health and quality of life in patients with schizophrenia Jørn Heggelund1,2,3§, Jan Hoff4,5*, Jan Helgerud4,6,7*, ... 65±17, 15±6 and 17±8 in men, and 68±23, 16±6 and 18±8 in women, respectively Peak oxygen uptake The VO 2peak for the men and women with schizophrenia are presented in Table Individual VO 2peak values...
- 31
- 373
- 0
Tài liệu Báo cáo khoa học: "A Unified Syntactic Model for Parsing Fluent and Disfluent Speech∗" ppt
... Crucially, any information about repair is stripped from the input, including partial words, repair symbols , and interruption point information While an integrated system for processing and parsing speech ... start and end of the reparandum 108 Conclusion This paper has described a novel method for parsing speech that contains speech repairs This system achieves high accuracy in both parsing and detecting ... for processing and parsing speech may use both acoustic and syntactic information to find repairs, and thus may have access to some of this information about where interruptions occur, this experiment...
- 4
- 581
- 0
Tài liệu Báo cáo khoa học: "A SPEECH-FIRST MODEL FOR REPAIR DETECTION AND CORRECTION" docx
... here are for prediction on only TI repair utterances 6We performed the same analysis for the last and first syllables in the reparandum and repair, respectively, and for normalized f0 and energy; ... presented a "speech-first" model, the Repair Interval Model, for studying repairs in spontaneous speech This model divides the repair event into a reparandum interval, a disfluency interval, and a repair ... acoustic-prosodic cues to repair detection, we propose a "speech-first" model of repairs, the REPAIR INTERVALMODEL (RIM) RIM divides the repair event into three consecutive temporal intervals and identifies...
- 8
- 502
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... observation of the first colonies in hematopoietic colony assays [55 ] The hematopoietic transcription factors SCL and GATA-2 were also expressed in these cells between days and 21 of differentiation ... indicated that the placenta acts as an additional extramedullary hematopoietic organ during embryonic and fetal development [52 ,53 ] Hematopoietic precursors found in the human placenta can give rise ... examine engraftment efficiency and functionality in various animal models of diseases before clinical medical application can become a reality Ontogeny of human hematopoiesis Hematopoietic ontogeny...
- 12
- 550
- 0
Báo cáo khoa học: "A Novel Burst-based Text Representation Model for Scalable Event Detection" pptx
... compare the performance of different text representation models for event detection, namely BurstVSM and boostVSM (He et al., 2007b; He et al., 2007a).7 For different representation models, we use ... proposed methods are both effective and efficient Burst-based Text Representation In this section, we describe the proposed burst-based text representation model, denoted as BurstVSM In BurstVSM, each ... clusters as events This algorithm can run a mutli-thread mode to speed up processing Our contribution can be summarized as two aspects: 1) we propose a novel burst-based text representation model, ...
- 5
- 1,126
- 0
Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria
... growth rate and the specific production rate to [LaH] and pH, the accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of ... capacity of the medium are known The amount of undissociated lactic acid is then further related to the total amount of lactic acid LaHtot and the pH by the lactic acid chemical equilibrium As ... a more theoretical analysis of the model Some mathematical properties of the model are discussed, and an easy-to-use method to take into account the evolution of pH and undissociated lactic acid...
- 12
- 625
- 0
Từ khóa: digital image processing techniques for the detection and removal of cracks in digitized paintings pptdigital image processing techniques for the detection and removal of cracks in digitized paintingsfarmers marketing capacity and strengthening the local seed system action research for the conservation and use of agrobiodiversity in bara district nepalgreen supply chain management ppt presentationcreating a minority supply chaina model for enhancing patient portrayalsintroduction to an application of lean green supply chain management externalintroduction to an application of lean green supply chain management internalorganizations green supply chain management and leedscor® supply chain operations reference model4case study a biomass supply chain geographically located in spainescos in peak demand period based on supply chain networkanswers 2000 a nonpoint source pollution model for water sediment and phosphorus losses3b s of supply chain networkvirtual private network vpn solution for lan interconnection and remote accessBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ