development of a mid-infrared technique for determination of soil nitrate content

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...
Ngày tải lên : 18/02/2014, 17:20
  • 11
  • 873
  • 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

... Access Methodology Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses Sarah Watson 1 , ... Ref- erence gene selection for quantitative real- time PCR analy- sis in virus infected cells: SARS corona virus, Yellow fe...
Ngày tải lên : 18/06/2014, 18:20
  • 5
  • 481
  • 0
Báo cáo hóa học: " Feasibility of the adaptive and automatic presentation of tasks (ADAPT) system for rehabilitation of upper extremity function poststroke" pptx

Báo cáo hóa học: " Feasibility of the adaptive and automatic presentation of tasks (ADAPT) system for rehabilitation of upper extremity function poststroke" pptx

... RESEARCH Open Access Feasibility of the adaptive and automatic presentation of tasks (ADAPT) system for rehabilitation of upper extremity function post- stroke Younggeun Choi 1,2 , ... needed for effective reha- bilitation of upper extremity functions [3-6]. In view of this shortcoming of the conventional medical practice model, a growing numb...
Ngày tải lên : 19/06/2014, 08:20
  • 12
  • 612
  • 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

... Access Methodology Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses Sarah Watson 1 , ... researchers of these viruses with a shortlist of potential housekeeping genes to use as normalisers for QPCR experiments. Back...
Ngày tải lên : 20/06/2014, 01:20
  • 5
  • 574
  • 0
báo cáo hóa học:" Improving accuracy of total knee component cementation: description of a simple technique" ppt

báo cáo hóa học:" Improving accuracy of total knee component cementation: description of a simple technique" ppt

... Note Improving accuracy of total knee component cementation: description of a simple technique William B Lutes, Michael A Flierl, Michael R Dayton and Steven J Morgan* Address: Department of Orthopaedic ... and anterior knee pain after total knee arthro- plasty. Clin Orthop Relat Res 2001, 392:46-55. 11. Matsuda S, Miura H, Nagamine R, Urabe K, Hirata G, Iwamot...
Ngày tải lên : 20/06/2014, 04:20
  • 4
  • 247
  • 0
Báo cáo hóa học: " A Nanopatterning Technique: DUV Interferometry of a Reactive Plasma Polymer" ppt

Báo cáo hóa học: " A Nanopatterning Technique: DUV Interferometry of a Reactive Plasma Polymer" ppt

... multiple irradiations.’’ Soppera told Nano Spotlight (Fig. 3). This approach developed by Soppera and his colleagues allows the generation of multi scale topographical or chemical images and creates ... field of biology are expected from this work: we have already validated that such surface was compatible with cell or bacteria development. Such patterned polymer films appear as excellent c...
Ngày tải lên : 22/06/2014, 01:20
  • 2
  • 210
  • 0
Báo cáo hóa học: " TWO TOPOLOGICAL DEFINITIONS OF A NIELSEN NUMBER FOR COINCIDENCES OF NONCOMPACT MAPS" pptx

Báo cáo hóa học: " TWO TOPOLOGICAL DEFINITIONS OF A NIELSEN NUMBER FOR COINCIDENCES OF NONCOMPACT MAPS" pptx

... N ∼ H  p 0 ,q 0  . (4.17) TWO TOPOLOGICAL DEFINITIONS OF A NIELSEN NUMBER FOR COINCIDENCES OF NONCOMPACT MAPS JAN ANDRES AND MARTIN V ă ATH Received 25 August 2003 The Nielsen number is a homotopic invariant and a lower ... have such a form. 66 Topological definition of a Nielsen number of (p 1 ,q 1 ). Note that this association is actually indep...
Ngày tải lên : 23/06/2014, 00:20
  • 21
  • 262
  • 0
Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx

Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx

... of Surgical Oncology 2010, 8:86 http://www.wjso.com/content/8/1/86 Page 5 of 7 RESEARC H Open Access The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric ... approximately 45 minute s before receiving an intravenous injection of 440 MBq of 18F-FDG. Scanning began 60 minutes later. A combined PET/CT in-...
Ngày tải lên : 09/08/2014, 03:22
  • 7
  • 470
  • 0
Báo cáo y học: "Ultrasound guided injection of dexamethasone versus placebo for treatment of plantar fasciitis: protocol for a randomised controlled trial" potx

Báo cáo y học: "Ultrasound guided injection of dexamethasone versus placebo for treatment of plantar fasciitis: protocol for a randomised controlled trial" potx

... outcomes and analysing data. Primary outcomes will be pain measured by the Foot Health Status Questionnaire and plantar fascia thickness measured by ultrasound at 4, 8 and 12 weeks. All data analyses ... Ultrasound guided injection of dexame- thasone versus placebo for treatment of plantar fasciitis: protocol for a ran- domised controlled trial Journal of Foo...
Ngày tải lên : 10/08/2014, 21:24
  • 8
  • 352
  • 0
Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps

Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps

... implementation in healthcare organizations, informed by the implementa- tion of a major patient safety initiative at a large, multi- site, academic hospital in Toronto, Canada. Candidate factors were retained ... Canada, 2 Department of Paediatrics, University of Toronto, Toronto, Canada, 3 Department of Health Policy, Management and Evaluation, University of Toronto, Tor...
Ngày tải lên : 11/08/2014, 05:21
  • 8
  • 347
  • 0
báo cáo khoa học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" doc

báo cáo khoa học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" doc

... Access Research article Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments Chad Andrew ... implementation in healthcare organizations, informed by the implementa- tion of a major patient safety initiative at a large, multi- site...
Ngày tải lên : 11/08/2014, 16:20
  • 8
  • 236
  • 0
Báo cáo y học: " Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorder" ppt

Báo cáo y học: " Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorder" ppt

... 10:100 http://www.biomedcentral.com/1471-244X/10/100 Page 5 of 11 STUD Y PROT O C O L Open Access Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorder Richard ... general practitioners and p sychother- apy services in England and Wales. 2. Euroqol 5 D [32] as a...
Ngày tải lên : 11/08/2014, 16:22
  • 11
  • 302
  • 0
Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx

Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx

... using primers VP22 F9 (5' ACTCTAGCTAGC ACGGCGCCAAC- CCGATCCAAGACA 3') and VP22 R8 (5' ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCT- GGACCCTCGACGGGCCGTCTGGGGCGAGA 3'). Addi- tionally, the gene ... kinase [3] or the BioMed Central Page 1 of 9 (page number not for citation purposes) Genetic Vaccines and Therapy Open Access Research Evaluation of the VP22 protein...
Ngày tải lên : 14/08/2014, 19:22
  • 9
  • 331
  • 0
Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx

Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx

... Finally, the jackknife standard deviation of the estimated quantile varies, for the 5% case, between 0.23 and 0.89, with a mean value of 0.52 and, for the 1% case, between ... and validity. Four methods are compared on simulated data. METHODS The four methods considered rely upon the same information structure and the same type of...
Ngày tải lên : 14/08/2014, 20:20
  • 17
  • 352
  • 0

Xem thêm

Từ khóa: