249 Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc
249. Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage doc
... like like."AL ROKER: "Do you like like? So what's the word like in German?" Like It or Not, a Discourse Marker Making Its Mark on a Wider Stage 09 May 2006AA: I'm Avi ... word like has gone from California slang to worldwide phenomenon."CARMEN FOUGHT: " ;Like is what we call a discourse marker, which means, like 'um' or 'uh,' it takes ... I'm Avi Arditti with Rosanne Skirble and this week on Wordmaster: a report from NBC News that caught our attention.RS: It& apos;s about a word that is spreading like no other.(MUSIC)FEMALE: " ;Like, ...
- 4
- 286
- 0
Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx
... FAM-CCAACgCCCTCAAC C-7T Forward primer CCGAGCCGGAGAGGGA Reverse primer GCACCCAAGACAGCAGAAAGT C-7-allele probe VIC-CATGGTTTCgGAGGCC T-7-allele probe FAM-ATGGTTTCaGAGGCC Effect of NaB ... Kuwahara 1, Koichi Iwaki 1, Takao Tamura 4, Nobuo Aoyama 5, Svetlana Markova 2, Masato Kasuga 4, Katsuhiko Okumura 1, 2, 3, Toshiyuki Sakaeda 2, 6 1. Department of Hospital Pharmacy, ... Sakaeda T, Nakamura T, Okumura K. Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmaco-dynamics of drugs. Pharmacogenomics. 2003; 4: 397–410. 37. Sakaeda T, Nakamura...
- 7
- 243
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... representation and as propor-tional covers for statistical analysis. Repeated-measures analysis ofvariance (ANOVA) was used to compare the proportional coversof individual substrate components among ... Cay did not perform appreciablybetter in comparison with daily means of in situ data than did Day or combined Day+Night SST data. Additional information on theperformance of the Pathfinder data ... com-plete-block ANOVAs for thecoverofhard corals,macroalgae,sponges, and CTB. Proportionaldata were arcsine-transformedprior to computation of theANOVAs. Significance tests forblock (station) effects assumeno...
- 13
- 583
- 0
Báo cáo khoa học: "A Hierarchical Bayesian Language Model based on Pitman-Yor Processes" docx
... ofnatural languages. Bayesian probabilistic mod-els also have additional advantages it is rela-tively straightforward to improve these models byincorporating additional knowledge sources andto ... methodsappear as differences among rare words, with thecontribution of more common words being neg-ligible. HPYLM performs worse than MKN on words that occurred only once (on average) andbetter on ... table (assign the word to the cor-responding draw from G0), or sits at a new table(assign the word to a new draw from G0).3 Hierarchical Pitman-Yor LanguageModelsWe describe an n-gram...
- 8
- 386
- 0
Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt
... plausible way. - The semantic knowledge plays a fundamental role in choosing a particular analysis. Milne argues that a one-word lookahead, with the substantial help of semantic information ... Issue on Natural Lan guage Processing, SlGART Newsletter 79 (1982). Konolige K.G.: A Framework for a Portable Natural Language Interface to Databases. In D.Sagalowicz (ed.): Mechanical Intelligence: ... categories. In this case all conditions a~ sociated with the different categories are evalu ated an~ in some cases more than one of them is matched. In all these cases the status of the ana...
- 8
- 412
- 0
Báo cáo khoa học: "A Statistical Machine Translation Model Based on a Synthetic Synchronous Grammar" docx
... 2.2.2 The SSG-based Translation ModelThe translation in our SSG-based translationmodel can be treated as a SSG derivation. A derivation consists of a sequence of grammar ruleapplications. To model ... derivations as a latentvariable, we define the conditional probability dis-tribution over the target translation e and the cor-Input: A source parse tree T (fJ1)Output: A target translation ... 2009 Conference Short Papers, pages 125–128,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLP A Statistical Machine Translation Model Based on a SyntheticSynchronous GrammarHongfei Jiang,...
- 4
- 339
- 1
Báo cáo hóa học: "Fabrication of a Highly Sensitive Chemical Sensor Based on ZnO Nanorod Arrays" doc
... sensitive chemical sensor based on a ZnO nanorodarray that is epitaxially grown on a Pt-coated Si substrate,with a top–top electrode configuration. To practically testthe device, its O2and NO2sensing ... meaning that the interfacialZnO layer is of an epitaxial quality and that the individualZnO nanorods are actually defect-free single crystals.To practically test the NRA chemical sensor with ... chemicalsensors based on ZnO NRAs.ZnO NRAs were synthesized on Pt-coated Si (001)substrates using a horizontal-type metal organic chemicalvapor deposition (MOCVD) system without using anymetal catalyst....
- 7
- 319
- 0
Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image " pot
... 10−5and reaches a plateau at 100%foraBERof10−3before reaching a peak at 200% for a BERof3× 10−2. Clearly additivity is not respected withinFlexWave-II and exhibits a large additivity deviation. ... the bitstream un-touched. We can see that the distortion resulting from a biterror at any location in the bitstream is always smaller thanthe distortion resulting from a truncation at the same ... distortion of allpossible protection allocations prior to the transmission, andpicked the best allocation based on the lowest distortionvalue. The full-search algorithm is not realizable with...
- 11
- 273
- 0
Báo cáo hóa học: " Research Article A Low-Complexity UEP Methodology Demonstrated on a Turbo-Encoded Wavelet Image Satellite Downlink" pptx
... 10−5and reaches a plateau at 100%foraBERof10−3before reaching a peak at 200% for a BERof3× 10−2. Clearly additivity is not respected withinFlexWave-II and exhibits a large additivity deviation. ... the bitstream un-touched. We can see that the distortion resulting from a biterror at any location in the bitstream is always smaller thanthe distortion resulting from a truncation at the same ... for any rateconstraint. This means that our low-complexity algorithmis very dynamic and can adapt to any rate condition with a simple search, without loss of optimality in the specific caseof...
- 11
- 243
- 0
Báo cáo hóa học: " Research Article Array Iterators in Lustre: From a Language Extension to Its Exploitation in Validation Lionel Morel" doc
... hardware. Moreover,this approach allows for a straightforward use of standardvalidation tools associated to the “Lustre without arrays.”2.1.3. Towards array iterators: some motivationsFor ... give a contractto that node. An assume-guarantee contract [25]isaformoflocal specification. It is made of an assertion Boolean clause,that specifies what the component expects from its environ-ment, ... used, with the condition thatfor every call to that node, this parameter be instantiated by a static constant. Finally, thewith operator allows for a staticrecursion m echanism in the language....
- 16
- 296
- 0
Từ khóa: students complete the text or notto score or not to scorea discourse copying algorithmhad god designed the world it would not bewhat not to say on a first datewhat not to say to a woman on a first dateBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ