Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc
Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc
... genes from three animalphyla is very unlikely to have arisen by chance, and suggests that a core set of developmental regulatory genes may beassociated with CNEs across all animal lineages.Because ... this evolution of regulatory elements may underlie the astoundingdiversification of animal body plans that was seen during theCambrian period approximately 550 million years ago.Materials and ... of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humansTanya Vavouri*†, Klaudia Walter‡, Walter R Gilks§, Ben Lehner¤¶ and...
- 14
- 257
- 0
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"
... correspondence: Aer Lingus, Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian, bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines, Cyprus Airways, Czech Airlines, ... data analysis and inter-pretation of the data as well as the writing of the manuscript.FGB participated in the data analysis and interpretation of thestudy. DS participated in the data analysis, ... frequently. A variety of low-cost carriers havemade air-travel accessible to a larger portion of the population,contributing to increasing passenger load. Additionally, theaverage passenger age...
- 6
- 639
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... 5¢-GGCCCTCAAAATGTTCCAGAATTGCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGAAGCGAGCTTATATCTTTTGCAATGAAGATAAATCATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCAAGTGCCTGCTTGATATATCAGATT-CA-3¢. H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCGGAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGGCCATAGCTTTGGTGGCATGAGTTTGGG-3¢. ... AppliChem(Darmstadt, Germany). All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt,Germany), Sigma (Deisenhofen, Germany) or from Appli-Chem (Darmstadt, Germany).Site-directed ... H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCGGAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGGCCATAGCTTTGGTGGCATGAGTTTGGG-3¢. S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAGTTTGGG-3¢. H24 4A: 5¢-CAAAGAAGCAGATCATATGGGAATGCTTTCGCAGCCAAGGG-3¢....
- 8
- 345
- 0
Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc
... technology/mechanisms Technology to support collaboration is available and placed rapidly in the hands of employees (KMAT)[103]Promoting external contacts We have a system that allows us to learn ... expressed in a way that couldbe inferred as an organisational characteristic (e.g., 'Ouremployees resist changing to new ways of doing things'[94]), and were excluded.Category analysisInitially, ... of absorptive andreflective capacity. In Organizational Learning and Knowledge 5thInternational Conference; 20 May 2003 Lancaster University. 37. Braadbaart O, Yusnandarshah B: Public sector...
- 15
- 386
- 0
Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt
... Stimulatory and inhibitory sig-nals normally confine myofibroblasts to the period of pulmonary alveolarization and myofibroblasts are rarelyobserved in the adult lung [18]. Understanding moreabout ... tissues obtained from P4 and P12animals that were stained concurrently. To avoid variabil-ity related to distances from the laser beam, alveolar entryrings located 1/4 to 1/2 of the way into the ... cytometry.Collection and analysis of Flow Cytometry dataFlow cytometry was performed at the University of IowaFlow Cytometry facility using the LSR II instrument (BDBioscience). An unstained sample was used to...
- 17
- 202
- 0
Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc
... al[18]should have adjusted their analysis to assume that incom-plete efficacy is actually achieved in clinical practice. Talleyet al's costs were measured accurately by applying correc-tion factors ... Intracoronary thrombolysis was used in 42% of patients later randomized to IABP therapy compared to 46% of patients in the standard therapy arm. Intravenousheparin was used for a mean of 5 days ... criteriawere an emergency cardiac cathererization within 24 h of an AMI which demonstrated an occluded IRA at first angi-ography, and restored IRA patency by primary angioplasty(n = 106), intracoronary...
- 6
- 575
- 0
Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx
... wereED12C (AGTGCTTCCTGCTGCTCCCA) and ED31C(CCATTACACAGGCCTGTCCAAAG) and the secondround primers used were DR7C (TCAACTCAACTGGTC-CAAAG) and DR8C (CACTTCTCCAATTGTCCCTCA) that yield data on 694 ... ourdata using only the information gained from pol datastrata and ignoring the env sequence data strata. In othercases, we form a subsample at random. For example, to simulate what we have ... monophyly. Homoplasy (multiplemutational hits at the same nucleotide site that causereversals and/or parallelisms) are very common in HIVdata, and long branches tend to be underestimated inlength...
- 12
- 331
- 0
Báo cáo y học: "Intensive care for the adult population in Ireland: a multicentre study of intensive care population demographics" pdf
... notparticipating in this dataset. A total of 72 traumatic brain inju-ries are described, of whom 32 were transferred to a neurosur-gical centre. There appeared to be a regional variation intransfer ... readmission rate to the ICUswas 7.5%, with a mortality of 23%. Analysis of the major dis-ease categories in the audit dataset revealed mortality rates of 32.3% for ALI/ARDS, 24.6% for severe sepsis and ... possible to extrapolate from the dataset thereasons for this difference.Limitations of the study include an inability to include all ICUs,and in relation to interhospital transfers an inability to...
- 6
- 337
- 0
Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx
... reduced ability to carry out daily tasks wasmerely a consequence of pain severity had to be reconsid-ered. Several studies have indicated that pain-related fearis one of the most potent predictors ... good for your health? Haworth Pastoral Press,Binghampton: NY; 1997. 39. Fayad F, Lefevre-Colau MM, Poiraudeau S, Fermanian J, Rannou F,Wlodyka Demaille S, Benyahya R, Revel M: Chronicity, recur-rence, ... organic disease. Thebelief that all pain was a direct result of tissue damage wasfirmly entrenched by the early 20th Century [2].By the late 1950's it became increasingly evident that...
- 5
- 355
- 0
Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx
... nasal discharg e and coughing)and rectal temperatures were recorded daily for 14 dayspost-inoculation (DPI), and nasal swab samples for thedetection of viral shedding were also collected daily ... tudy, while 3 dogs lackedsymptoms. All of the animals seroconverted a s assessedby a CIV competitive ELISA (data not shown). Clinicalsigns were observed from 4 to 8 DPI, and viral sheddingwas ... Smith W, Andrewes CH, Laidlaw PP: A virus obtained from influenzapatients. Lancet 1933, 222:66-68.14. Baccam P, Beauchemin C, Macken CA, Hayden FG, Perelson AS: Kinetics of influenza A virus...
- 4
- 279
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenthe evolution of the national curriculum from butler to ballsevolution of ground water chemistry from recharge to discharge areas in the atlantic coastal plainbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP