Báo cáo sinh học: " A new view on dam lines in Polish Arabian horses based on mtDNA analysis" doc

... purchased in the Near East and admitted as purebred Arabian mares.610 I. G a zewska et al.Table I. Dam lines in Arabian horses in Poland: founders and main branches of the lines. * In brackets: ... Available online at:c INRA, EDP Sciences, 2007 www.gse-journal.orgDOI: 10.1051/gse:2007025Original article A new view on dam lines in Polish Arabian horses based o n mtDNA analysisIwona ... the pedigree dataof Polish dam lines using mtDNA analysis. The analyses of a 458 bp mtDNA D-loop fragmentfrom representatives of 15 Polish Arabian dam lines revealed 14 distinct haplotypes. The...

Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt

... Modular organization of inteins and C-terminalautocatalytic domains. Protein Sci 1998, 7:64-71.15. Amitai G, Dassa B, Pietrokovski S: Protein splicing of inteins withatypical glutamine and aspartate ... disease virus 1 (LDV), Amsacta moorei entomopoxvirus (AME), Variola virus, Asfarvirus, eukaryotic DNA polymerase α and δ catalytic subunits, and archaeal DNA polymerase I. Intein containing ... alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domainsFigure 3Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains. The Mimivirus...

Báo cáo sinh học: "A new Robertsonian translocation, 8/23, in cattle" potx

... Note A new Robertsonian translocation,8/23, in cattleL Biltueva,S Sharshova, A Sharshov,T LadyginaP Borodin A GraphodatskyInstitute of Cytology and Genetics, Siberian Branch ... re-vealed in Grey Ukrainian cattle.* Correspondence and reprintsDISCUSSIONThe comparative analysis of GTG- and RBG-banding patterns of the translocationchromosome and its ... animals (3Q and 4d ) of Grey Ukrainian cattle, heterozygous for a Robert-sonian translocation, were studied. The information on relationships between theaffected animals...

Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf

... textual organisation information, non-hierarchical conceptual information and speech act information. Penman has a rich variety of inquiries dealing with such information and so makes available ... bears for furthering understanding of the translation process. 1 Introduction In this paper we describe a framework for research into translation that draws on a combination of two existing ... as a concept that specializes a more general relation 'g-spatio-temporal' in UMG. The UMa 'g-spatio- temporal' is further linked, by the preparatory map- ping already...

Báo cáo sinh học: "A new, fast algorithm for detecting protein coevolution using maximum compatible cliques" pptx

... distance matrices as a new indicator of protein-protein interactions. Bioinformatics 2006, 22(20):2488-2492.11. Pazos F, Juan D, Izarzugaza JM, Leon E, Valencia A: Prediction of ProteinInteraction ... 1989,5:164-166[http://evolution.genetics.washington.edu/phylip/progs.data.prot.html].20. Razick S, Magklaras G, Donaldson I: iRefIndex: A consolidated proteininteraction database with provenance. BMC Bioinformatics ... protein-proteininteractions was compared for the two algorithms as in [14]. Instead of using multiple individual databases ofprotein interactions, we used the iRefIndex database[20]http://irefindex.uio.no,...

Báo cáo y học: "A global view of gene expression in lithium and zinc treated sea urchin embryos: new components of gene regulatory network" pot

... results accessible in the sea urchinWISH database [22].Zinc treatment expands the neuronal apical plate by downregulating vegetal signaling and oral markers, and upregulating aboral markersThe ... Database [23], the WISH database [22],and the genome database [76]. The sea urchin genome anno-tation data are accessible via the Baylor College GenomeProject annotation database [25,77].Additional ... sea urchin web applica-tion was done on a dual core 64 bit computer running a Linuxoperating system using an Apache webserver [69]. The data-base was implemented with a relational sqlite3 database...

Báo cáo sinh học: "A new Robertsonian translocation in Blonde d’Aquitaine cattle, rob(4;10)" pot

... digested in a trypsin solution (2.5 g/1) and grownOriginal article A new Robertsonian translocation in Blonde d’Aquitaine cattle, rob(4;10)I Bahri-DarwichEP Cribiu1HM BerlandR ... in 1 paternal half-sister and not in the mother and the maternalhalf-sister.As with a majority of Robertsonian translocations found in animal populations,the 4;10 translocation ... theanimals at the Domaine Experimental de Carmaux (INRA) is gratefully acknowledged.We thank H Hayes for her advice and help in chromosomal analysis (INRA, Laboratoirede...

Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx

... bpBglIINheIAflIIKpnIBamHISpeIEcoRIPstIEcoRVNotIBsiEIXbaIApaIClaICmRep CRep A pCMVATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGAGCTCGGATCCGGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAT7 ... and ii) a prokaryotic region allowing replication and selection of bacteria. In order to evaluate pValacfunctionality, the gfp ORF was cloned into pValac (pValac:gfp) and was analysed by transfection ... A pCMVATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGAGCTCGGATCCGGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAT7 promoter/priming...

Báo cáo sinh học: " A new method aimed at using the dominance variance in closed breeding populations" pot

... w2 h1d" alt ="" Original article A new method aimed at usingthe dominance variance in closedbreeding populationsM ToroCIT-INIA, Departamento de Produ.ccion Animal,Apartado 8111, ... conclusion, the use of dominance variance in within population selectionprogrammes is an open question that can be tackled by an adequate planningof evaluation, selection and ... obtained with d = 1, indicatingthat a lower inbreeding and, therefore, a better performance of the candidates forselection, can be obtained maintaining at the same...

Báo cáo khoa học: "A Generative Blog Post Retrieval Model that Uses Query Expansion based on External Collections" potx

... Experiments in Automatic Document Processing. Prentice Hall.Sakai, T. (2002). The use of external text data in cross-language information retrieval based on machine transla-tion. In Proceedings IEEE ... phenom-ena that we also observed in other pairwise com-parisons. Based on this discussion, we also con-sider a combination of approaches.8.1 EEM1 vs. the BaselineWe zoom in on EEM1 and make a per-topic ... In LanguageModeling for Information Retrieval, Kluwer InternationalSeries on Information Retrieval. Springer.Lavrenko, V. and Croft, W. B. (2001). Relevance based lan-guage models. In SIGIR...

Xem thêm

Từ khóa: báo cáo khoa học sinh học trạng thái hiện sinh báo cáo khoa học báo cáo sinh thái học a new view on the process of translation báo cáo trường học thân thiện học sinh tích cực Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ