Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx
... some projects, mainly in the medicine specialty of the medical sector (8.9%)Although QAAP is one of the six projects of the HEEP,8.9% of the medical sector projects of the HEEPF addressed the ... CentralPage 1 of 8(page number not for citation purposes)Human Resources for HealthOpen Access Review Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian ... conclusion, educational enhancement in the medical sector in Egypt could be apparently achieved through the HEEPF competitive projects. A study of the long-term impact of these projects on the quality of education...
- 8
- 697
- 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... managed the VCT training program from the Caribbean; and to Barbara McGaw (The Caribbean HIV/ AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program. ... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar-buda, Dominica, Grenada, and Turks & Caicos in 2005.Clinical Skills CourseData from the ... skills and advanced training skills, as well as the number of trainingseach clinical trainer and advanced trainer had conductedsince the training.Follow-Up ActivitiesDrawing on contact information...
- 8
- 450
- 0
Báo cáo sinh học: " Clearance of an immunosuppressive virus from the CNS coincides with immune reanimation and diversification" pptx
... CentralPage 1 of 16(page number not for citation purposes)Virology JournalOpen AccessResearch Clearance of an immunosuppressive virus from the CNS coincides with immune reanimation and diversificationHenning ... adaptive immune repertoire, which includes the mobilization of CD4+ T cells and B cells, is responsible for the eventual clearance of clone 13 from the CNS, and, quite possibly, the periphery. Immune ... post-infection, and this was associated with a rapid decline in virus from the periphery. Coincident with this " ;reanimation phase" was a massive influx of CD4 T and B cells into the CNS and a...
- 16
- 378
- 0
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx
... immunological course of acute hepatitis C in asymptomatic patients with spontaneous clearance: patients with spontaneous clearance in the absence of anti -HCV. HCV- RNA levels, ALT levels and T cell ... the immunopathogenesis of HCV- infection and maybe anexplanation for the rather low seroconversion rate afteroccupational exposure to HCV. The data should also beconsidered in the management of accidental findings ... patients. Thus, these cases highlight that clearance of low levels of HCV viremia is possible in the absence of a strong adaptive immune response which might explain the low seroconversion rate...
- 11
- 528
- 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx
... 1 of 5(page number not for citation purposes)Virology JournalOpen AccessResearch Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/AlixShuzo Urata1,2,3, Hideyoshi Yokosawa3 and ... mechanism of HTLV-1 budding in detail, we analyzed HTLV-1 budding using dominant negative (DN) forms of the class E proteins.Results: Here, we report that DN forms of Vps4A, Vps4B, and AIP1 inhibit HTLV-1 ... fetal bovine serum and penicillin-streptomycin at 37°C.The involvement of Vps4A and Vps4B in HTLV-1 Gag bud-dingFigure 2The involvement of Vps4A and Vps4B in HTLV-1 Gag budding. A. 293T cells...
- 5
- 303
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... Gaps introduced during alignment are indicated by a dot.A63TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA ... CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCG...
- 12
- 354
- 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu- R5-F, GGATCCATGTTAAATTTA-GATTATAAATTAGGAGTA GG and Vpu- R5-R, GAAT-TCATTACAAATCATTAACATCCAAAAGCC. The amplifiedfragments designated as ... AGTAGTAGCAATAATAATAGCAATAGCTGTGT-GGTCCATAGTAATCATAGAATAGG and NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG...
- 11
- 436
- 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... AccessResearch Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in IrelandJohn F Menton*, Karen Kearney and John G MorganAddress: ... hospitals.Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developedbased on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validatedusing a ... assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concludedthat the predominant genotype circulating in these...
- 8
- 535
- 1
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf
... Hirabayashi Y, Kikuta K, Suzuki Y, Nagamine T,Aizawa C, Nakagawa M, Kurata T: Functional role of respiratorytract haemagglutinin-specific IgA antibodies in protection against influenza. Vaccine ... Hagiwara Y, Chen Z,Kadowaki SE, Tsujimoto H, Kurata T, Tamura SI: Induction of innate immunity by nasal influenza vaccine administered in combination with an adjuvant (cholera toxin). Vaccine ... parenterally vaccinated mice, particularly in upper airways. Intranasal vaccination engendered stronger protection and a higher proportion of G 2a Abs than parenteral vaccination, and the strength of protection...
- 14
- 515
- 0
Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx
... an analogy to the extended biological role of the MHC (or HLA) part of the vertebrate immune system. Some of the disadvantages of several of the large number of extant alleles of the MHCsystem ... both the CI and rII proteins areinhibitory to the genome of the cell that created them, butthey aid the host population by either inhibiting the growth of the resident pathogen or by killing their ... all the relevant ways that the pathogens of prokaryotes endup helping their host by their own behavior and delaytheir host's destruction, and thereby increase the survival of the species of...
- 9
- 490
- 0
Báo cáo sinh học: " Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation" doc
... Access Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugationChristine V Ichim1,2and Richard A Wells1,2,3,4*AbstractBackground: Viral ... 7:910-913.doi:10.1186/1479-5876-9-137Cite this article as: Ichim and Wells: Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation. Journal of Translational Medicine 2011 9:137.Submit ... by flow cytometry of transduction by retrovirus following concentration using different numbers of rounds of centrifugation. 1 μL of retrovirus was added for eachtransduction. B. Titration of...
- 8
- 303
- 0
Báo cáo sinh học: " Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein" doc
... membrane fusion. Peptides Inhibition of Hendra virus and Nipah virus infection by N-terminal and C-terminal pegylated heptad peptidesFigure 6 Inhibition of Hendra virus and Nipah virus infection by ... availability of NiV in the Inhibition of Hendra virus and Nipah virus infection by capped heptad peptidesFigure 5 Inhibition of Hendra virus and Nipah virus infection by capped heptad peptides. Vero ... moietyHypothetical models of the transmembrane (F1) glycoproteins of Hendra virus and Nipah virusFigure 1Hypothetical models of the transmembrane (F1) glycoproteins of Hendra virus and Nipah virus. The...
- 15
- 387
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... who practiced either a ballistic or a ramppinch task, an increase in force and acceleration, asso-ciated with an increase in MEP amplitude, was observed in the muscle involved in the training, ... 3 of 8 RESEARC H Open Access Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscleViola Giacobbe1*, Bruce T Volpe1, Gary ... Importantly, the direction change of the movement was associated with a significant decrease in MEP amplitude of the antagonist to the trained muscle, rather than an increase in MEPamplitude of the...
- 8
- 432
- 0
Báo cáo sinh học: " Precision of methods for calculating identity-by-descent matrices using multiple mar" pot
... 15 cM.2.5. Index for information from the markersAn information index was presented in order to provide some understanding of the precision of the methods for calculating IBD matrices. It considers ... results of a comparison of a deterministicmethod and an MCMC based method for calculating IBD matrices for a number of scenarios of population structure, density of marker map, and heterozygosity of ... objective of this study was to evaluate methods for calculating matrices conditional on multiple markers regarding the precision of the matrices andtheir performance in common animal breeding applications....
- 23
- 206
- 0
Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot
... of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 geneSolange SOULIER a , Marthe ... using the BAC DNAas the template and oligos 5GGTCGACTTATATATTTATGAACACATTTA 3and 5CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCT-GAAATGGGGTCACCACACT 3. The second primer contains at ... 3 of the Cyclin T1 gene, the size of the PCR product indicates that it derivesfrom a cDNA. NTg: non -transgenic mice. Detection of the murine Cyclin T1 mRNA in the NTg sample indicates that the...
- 9
- 359
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP