Báo cáo y học: "The genome sequence of Podospora anserina, a classic model fungus" pps
Báo cáo y học: "The genome sequence of Podospora anserina, a classic model fungus" pps
... ffuummiiggaattuussaanndd AA oorryyzzaaee Nature 2005, 443388::1105-1115.7. Fedorova ND, Khaldi N, Joardar VS, Maiti R, Amedeo P, AndersonMJ, Crabtree J, Silva JC, Badger JH, Albarraq A, Angiuoli ... S, Doonan JH, Yu J, Vienken K, Pain A, FreitagM, et al.: SSeeqquueenncciinngg ooff AAssppeerrggiilllluuss nniidduullaannssaanndd ccoommppaarraattiivvee aannaallyyssiisswwiitthh AA ffuummiiggaattuussaanndd ... phylogenetically closely related.For instance, the genomes of the three Aspergillus species A. nidulans, A. fumigatus and A. oryzae, revealed only 68%average sequence identity between any species...
- 4
- 233
- 0
Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps
... broad range of uncultivatable organismsfrom which only a handful of contaminant-free DNA can beextracted.Finally, an important goal of the present study was to gather a large amount of genome ... abortus0.2 Nosema ceranae Nosema ceranae Nosema ceranae Nosema ceranae Antonospora locustae Antonospora locustae Antonospora locustae Octosporea bayeri Enterocytozoon bieneusi Paranosema ... branching of eukary-otes. J Biochem 1996, 120:1095-1103.10. Kamaishi T, Hashimoto T, Nakamura Y, Nakamura F, Murata S,Okada N, Okamoto K, Shimizu M, Hasegawa M: Protein phylogeny of translation...
- 12
- 400
- 0
Báo cáo y học: "The current status of targeting BAFF/BLyS for autoimmune diseases" pps
... results in a decreasedCommentaryThe current status of targeting BAFF/BLyS for autoimmunediseasesMeera Ramanujam and Anne DavidsonDepartments of Medicine and Microbiology and Immunology, Albert ... they induce B cell depletion and a markeddelay in the expansion of activated and memory T cells.The addition of a short course of cytotoxic T lymphocyte-associated antigen 4 (CTLA4)Ig to TACI-Ig ... lipopolysaccharide or anti-CD40Lstimulation and an increase in apoptosis [14], but thesignaling pathways that mediate this effect have not yetbeen elucidated. In addition, TACI might act as a sink...
- 6
- 427
- 0
Báo cáo y học: "The "incidental" episode of ventricular fibrillation: a case report." pdf
... Vereckei A: Pseudo-ventricular tachycardia: electrocardio-graphic artefact mimicking non-sustained polymorphic ven-tricular tachycardia in a patient evaluated for syncope. Heart2004, 90:81.4. Knight ... SA, Morady F: Physi-cian interpretation of electrocardiographic artifact thatmimics ventricular tachycardia. Am J Med 2001, 110:335-338."Ventricular fibrillation" – black dots mark ... http://www.jmedicalcasereports.com/content/1/1/72Page 2 of 2(page number not for citation purposes)ciate this artifact amongst physicians of differentspecialties and levels of experience.List of AbbreviationsVF...
- 2
- 272
- 0
Báo cáo y học: " The necessary future of chiropractic education: a North American perspective" doc
... exchange, professionals are granted considerableautonomy in setting standards and in the conduct of theirwork. Any professional level educational system mustadopt the tenets of the academy: ... education atthe turn of the century was an exercise in inescapable con-clusions. It was less a pragmatic study aimed at unearthingproblems within medical education than it was a fact-finding task ... standards no longer operated. All chiro-practic colleges had achieved accreditation by 1995 andall also now hold accreditation with regional accreditingagencies for their baccalaureate programs...
- 5
- 181
- 0
Báo cáo y học: "The acute management of trauma hemorrhage: a systematic review of randomized controlled trials" ppsx
... correction of coagul opathy as a defined end-point. Newer methods of assessing hemostasis such asthromboelastography were not used and a definition of coagulopathy was variable and provided by a limitednumber ... significant coagulopathy[8,9]. Management of trauma hemorrhage depends on a multifactorial approach of timely surgical intervention,fluid resuscitation and blood transfusion therapy [10].Advances ... have taken place in our un derstanding of the pathophysiology of trauma induced coagulopathy[11,12], in the availability of rapid diagnostic modalities[13], and the int roduction of hemostatic...
- 10
- 348
- 0
Báo cáo y học: "The genome of Apis mellifera: dialog between linkage mapping and sequence assembly" pdf
... scaffoldsto get a reasonable picture of the genome organization.Additional data filesAdditional data file 1, a list of theprimers used for mapping is availablewith this article online.AcknowledgementsThis ... 230 cM) wasassuredly a great advantage because itsuffices to genotype small families toobserve recombination between markersat a short physical distance. The sameresolution in organisms with ... two-thirds of the total) and they showed only fourlocal and unresolved mistakes (0.3 %).In addition, the 387 markers that are at a null genetic distance within scaffoldsare always clustered in the sequence. This...
- 4
- 249
- 0
Báo cáo y học: " The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging" potx
... separated by SDS PAGE gel (12% acrylamide),and visualized by fluorography or analyzed by phosphor-imaging using The Discovery Series Quantity One (Bio-Rad, Hercules, CA).Steady state radiolabeling ... pSARM4was subcloned into the SmaI-SphI sites of pALTER. Muta-genesis was carried out using the mutagenic oligonucle-otide (5'-GTTTGTGCTCTTAACAGAACTGGGAAAGTACTTGATAAACCTTTATCTTGTAGAGAGG),to ... caused a rapid turn (A) Western Blot analysis of intracellular procapsid assembly using Gag fractionation techniquesFigure 2 (A) Western Blot analysis of intracellular procapsid assembly using Gag...
- 14
- 254
- 0
Báo cáo y học: "Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle" pptx
... cerevisiae haveidentified two major pathways for the degradation of mRNA,both of which are deadenylation dependent: 5' to 3' decay and3' to 5' decay [7]. Both pathways of mRNA ... 5'-TGACCAAAAAGATTT-TACTGAA-3' for the PF13_0116 5'-RACE outer primer; 5'-AAAACTTTCCAAACTTTCACAA-3' for the PF13_0116 5'-RACE inner primer. Herculase (Stratagene, La Jolla, ... Guerra CA, Noor AM, Myint HY, Hay SI: The global dis-tribution of clinical episodes of Plasmodium falciparummalaria. Nature 2005, 434:214-217.2. Yamey G: Roll Back Malaria: a failing global health...
- 12
- 324
- 0
Báo cáo y học: "The global landscape of sequence diversity" docx
... specific to taxonomic groupOther bacterial groupsCyanobacteriaActinobacteriaSpirochaetesCrenarchaeotaNanoarcheotaAlphaproteobacteriaBetaproteobacteriaGammaproteobacteriaEuryarcheotaFirmicutesDeltaproteobacteriaEpsilonproteobacteria Genome ... theeukaryotic partial genome datasets are more geneticallydiverse than the bacterial datasets. Previously, it has beensuggested that many apparently novel sequences may ratherrepresent artifacts ... synthetaseTR-000121 Histidyl-tRNA synthetaseTR-000150 Lysyl-tRNA SynthetaseTR-000310 Sulfate adenylate transferaseTR-000735 Methionyl-tRNA SynthetaseTR-000216 Aspartyl/asparaginyl-tRNA synthetaseTR-000170...
- 17
- 302
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP