Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx
Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx
... 14:R209http://ccforum.com/content/14/6/R209Page 3 of 8RESEARC H Open AccessValidation of a new transpulmonary thermodilution system to assess global end-diastolic volume and extravascular lung waterKarim Bendjelid1*, Raphael Giraud1, ... Siegenthaler1, Frederic Michard2AbstractIntroduction: A new system has been developed to assess global end-diastolic volume (GEDV), a volumetricmarker of cardiac preload, and extravascular lung ... measure-ments according to the method proposed by Bland and Altman [14].Reproducibility of TPTD measurements was assessedby calculating the standard deviation/mean ratio of tri-plicate measurements...
- 8
- 285
- 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarmprocedure. Finland Helsinki; 2005, 56.7. Kuisma K, Boyd J, Väyrynen ... - anevaluation, with performance indicators. Scandinavian Journal of Trauma,Resuscitation and Emergency Medicine 2011 19:19.Submit your next manuscript to BioMed Central and take full advantage ... performanceindicators were used to evaluate and compare the old and new EMCC organizations.Results: A total of 67 610 emergency calls were analyzed. Of these, 54 026 were from the municipality-basedcenters...
- 5
- 495
- 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... PRIMARY RESEARCH Open AccessValidation of a specific measure to assess health-related quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ ... = ‘TOlerability and quality Of Life’; YMRS = Young Mania Rating Scale.Montejo et al. Annals of General Psychiatry 2011, 10:6http://www.annals-general-psychiatry.com/content/10/1/6Page 6 of ... Hospital Universitario de Salamanca, Salamanca,Spain.2Department of Psychiatry, Hospital del Henares, Coslada, Madrid,Spain.3BAP Health Outcomes Research, Oviedo, Spain.4Value DemonstrationUnit,...
- 8
- 476
- 0
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... chronobiology. Since this type of research generally requires a large amount of data fromseveral weeks of monitoring, the use of automatic systemsis necessary.Various types of automatic systems to measure ... designed and validated several years ago.The new apparatus allows easier recording of animals bymeans of a battery of radar devices housed in specific ele-ments and arranged in a smaller space with ... non-stop and easy to analyse, preferably with a computer; 7) the apparatus must have a simple calibra-tion method so that its sensitivity is replicable and stableover time; and 8) the apparatus...
- 8
- 586
- 0
Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf
... CP70-for(GGTTGTGAAGGNCCNTGTAAGGTYCA) and SL2150-rev (GCWGCAAAGACACCAAYGCCGT) were uti-lized to amplify a complementary and partially over-lapped DNA -A segment . Amplification of DNA-Bsequences was performed ... subsequentlyscored for the appearance of disease symptoms. Theinfectio n status of the inoculated plants was assessed byvisual inspection of symptoms and by PCR analysis of all plants at the end of the experiment.Reassortment ... Científica y Tecnológica, A. C., Camino a la Presa San José, 78216 San Luís Potosí, SLP, México.2UniversidadAutónoma Agraria Antonio Narro. Departamento de Parasitolog a Agrícola.Bellavista, C.P....
- 15
- 694
- 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
... We report a new ultra sensitive real time PCR molecular beacon based assay with remarkableanalytical and clinical sensitivity, calibrated against the WHO 1stInternational standard.BackgroundChronic ... detection system, with remarkable analytical and clinical sensitivity, calibrated against the WHO 1stInternational standard.AcknowledgementsThis study was supported by Gilead. DP, AK, HH and VS ... statisticalanalysis; AH was the study coordinator and participated to the writing and editing of the manuscript. All authors read and approved the finalmanuscript.Competing interestsThe authors...
- 6
- 536
- 1
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... ten days. Comparison between pre- and post-raltegravir viralload measurements was done. Viral load values at Day 0, Day 7 and Day 10 were compared with viral loads at 27 and 166 days prior to treatment ... primer),SIV2-D 5’ GGCACTATTGGAGCTAAGAC 3’ (reverseprimer), SIV-P 6FAM-AGATTTGGATTAGCA-GAAAGCCTGTTGGA-TAMRA (TaqMan probe). Thesignal was finally compared to a standard curve of known concentrations from ... BIOQUAL, Inc. Rockville, MD, according to standards and guidelines as set forth in the Animal Wel-fare Act and The Guide for the Care and Use of Laboratory Animals, as well as according to animal...
- 19
- 317
- 0
Báo cáo y học: "Characterization of a new simian immunodeficiency virus strain in a naturally infected Pan troglodytes troglodytes " ppt
... performed all molecular, phylogenetic and diversity analyses with thecontribution of AA. EN, NW, ML, and UT initiated and coordinated collaborationbetween Yaoundé Zoo/Sanctuary and the laboratory of ... Lutwama F, Serwadda R, Mayanja-Kizza H, Shihab HM, Ronald A, Kamya MR,Thomas D, Johnson E, Quinn TC, Moore RD, Spacek LA: Evaluation of Dynabeads and Cytospheres compared with flow cytometry to enumerate ... clinical and laboratory monitoring. GTB rescuedthe animal and is involved in daily care of Cam155/Ch-Go. ED and EM provideadvice on clinical monitoring. LE, AA, ML and MP wrote the manuscript. AA,...
- 13
- 336
- 0
Báo cáo y học: " Isolation of a new HIV-2 group in the US" pptx
... that thepatient was HIV-2 infected and provided valuable demo-graphic data. RG, AG, CA, and PAM amplified gag and per-formed the phylogenic analysis. All authors read and approved the final ... van der, Awasana AA, Sarge-Njie R, Sande M van der, Jaye A, Sabally S, et al.: Sixteen years of HIV surveillance in a WestAfrican research clinic reveals divergent epidemic trends of HIV-1 and ... immunoblot was positive.The presumptive diagnosis was that Patient X had an HIV-2 infection. However, a PCR assay from a commercial lab-oratory for HIV-2 proviral DNA was negative (LabCorp,Research...
- 3
- 250
- 0
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... 5'-TGCAAATAAAT-GGATCCAACAAGTAGCAAAAGT-3' (nt 5968 to 6000).Mutagenic primers 5'-GGGACAGCAAGCTAAGTATCAA-3' (nt 6113 to 6134) and 5'-TATCAACCCCAGCTAAG-TAAGCAA-3' (nt 6129 to 6152) were used to ... Forward primerM5e (5'-GGAATTCATGGATGCTGGGGCCAGATAC-3'; nt6012 to 6032) and reverse primer M3b (5'-CGGGATCCG-CAAGCAGCAAGCTTCTCCTTATATA-3'; nt 9098 to 9073)contained EcoRI and ... cedex 5, France and 4Department of Microbiology, University of Washington, Seattle, WA 98195-8070, USAEmail: Stephen Valas* - s.valas@niort.afssa.fr; Morgane Rolland - mrolland@u.washington.edu;...
- 17
- 422
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP