Báo cáo y học: "Medical emergency motorcycle – is it useful in a Scandinavian Emergency Medical Service?" docx
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot
... Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity Shilpa Gandre, Zippi Bercovich and Chaim KahanaDepartment ... 689–697.26. Matsufuji, S., Miyazaki, Y. , Kanamoto, R., Kameji, T.,Murakami, Y. , Baby, T.G., Fujita, K., Oh no, T. & Hayashi, S.(1990) Analyses of ornithine decarboxylase antizyme mRNA with a cDNA ... Murakami, Y. , Matsufuji, S., Kameji, T., Hayashi, S., Igarashi,K., Tamura, T., Tanaka, K. & Ichihara, A. (1992) Ornithine decarboxylase is degraded by the 26S proteasome withoutubiquitination....
- 7
- 382
- 0
Báo cáo y học: "Clinical Profiles of Chronic Hepatitis C in a Major County Medical Center Outpatient Setting in United States" pptx
... patients. Ying-Cho Lin, MS, is a Research Biostatistician, Medical Genetics Institute, Cedars-Sinai Medical Center. Karen Lindsay, MD, was on the faculty at UCLA after completion of training in internal ... verify the accuracy of clinical discriminant score in diagnosing cirrhosis, the clinical diagnosis was further assessed in 79 patients who had pathological diagnosis. Compared to pathological ... disease, factors associated with HCV cirrhosis, and prevalence of previous HBV infection as evidenced by total anti-HBc in publicly-funded patients in a major county medical center outpatient setting. ...
- 9
- 388
- 0
Báo cáo y học: "Evaluating the Safety of Intranasal Steroids in the Treatment of Allergic Rhinitis" docx
... Safety of Intranasal Steroids in the Treatment of Allergic RhinitisKetan Sheth, MD, MBAGiven that intranasal corticosteroids (INCs) are widely considered first-line therapies for treatment of ... affecthypothalamic-pituitary-adrenal-axis function. Allergy AsthmaProc 2004;25:115–20.Sheth, Safety of Intranasal Steroids in Treatment of Allergic Rhinitis 129 ORIGINAL ARTICLEEvaluating the Safety ... development of glaucoma orincreased intraocular pressure. Medication class warningssuggest that nasal and inhaled corticosteroids may result in Sheth, Safety of Intranasal Steroids in Treatment of Allergic...
- 5
- 395
- 0
Báo cáo y học: "Traditional DMARD therapy: is it sufficient" potx
... inflammatory polyarthritisat five years. Arthritis Rheum 2003, 48:46-53.25. Symmons D, Harrison B: Early inflammatory polyarthritis:results from the norfolk arthritis register with a review of theliterature. ... Uffmann M, SmolenJS: Benefit of very early referral and very early therapy withdisease-modifying anti-rheumatic drugs in patients with earlyrheumatoid arthritis. Rheumatology 2004, 43:906-914.21. ... Arthritis Register [24]. Inthis inception cohort, patients with early inflammatorypolyarthritis (not RA) were included and followed regularlyover an extended period [25]. This initiative is...
- 6
- 259
- 0
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... Kataoka Y, Seto Y, Iwata N,Kaneda Y, Matsumoto K, Nakamura T, Ueki T, et al.: Hepatocyte growth factor ameliorates acute graft-versus-host diseaseand promotes hematopoietic function. J Clin Invest ... Sano11Division of Rheumatology and Clinical Immunology, Department of Internal Medicine, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan2Division of Hematology, Department ... Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, et al.: In vivo transfection of cis element "decoy" against nuclear factor- κB binding...
- 9
- 463
- 0
Báo cáo y học: "Retroviral rebound syndrome after treatment discontinuation in a 15 year old girl with HIV attracted through mother-to-child transmission: case report" doc
... rebound syn-drome after cessation of highly active antiretroviral treat-ment (HAART) in a girl infected with HIV since birth viavertical transmission. Case report A 15 year old girl with HIV since ... treatment discontinuation in a 15 year old girl with HIV attracted through mother-to-child transmission: case reportVanda Friman and Magnus Gisslén*Address: Department of Infectious Diseases, ... year old girl with retroviral rebound syndrome after discontinuation of highly activeantiretroviral treatment (HAART) due to side effects is presented. The patient was transmitted with HIV at...
- 3
- 579
- 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... based on the method byCawthon et al[33]. Briefly, commercially obtained telo-mere specific primers; CGGTTTGT TTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT (forward) and GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT ... 2008,129:60-66.doi:10.1186/1423-0127-18-41Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden. Journal of Biomedical Science ... separate into anaqueous RNA phase, an organic protein layer and a DNA interphase.RNA was extracted by adding 0.5 ml isopropanol tothe aqueous phase and incubating at-20°C overnight,then centri...
- 11
- 527
- 0
Báo cáo y học: "Technical phosphoproteomic and bioinformatic tools useful in cancer research" potx
... spec-trometry via SILAC and immunoaffinity purification oftyrosine phosphorylated peptides to profile candidateSRC-substrates induced by the CSF-1R tyrosine k inaseby comparing the phosphotyrosine-containing ... combined with IMAC and resulted in greater recovery and identification by MS of interest-ing phosphorylated peptides originating from yeast pher-omone signalling pathway and membrane proteinsrespectively ... unknownphosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools. Journal of ClinicalBioinformatics 2011, 1(1):16[http://www.jclinbioinformatics.com/content/1/1/16].2....
- 14
- 479
- 0
Báo cáo y học: " Long-term results of diaphragmatic plication in adults with unilateral diaphragm paralysis" docx
... of 7 Discussion In this long-term follow-up study, we evaluated an aver-age of 5.4 (4-7) years outcome of diaphragmatic plication in adults with sympto matic unilateral diaphragmatic paralysis. ... recovery from diaphragmatic paralysis in adults. Potential benefits of diaphragmatic plication in adults is still uncertain, especially in long-term period.There is limited data on the long-term ... properly cited. In this study we aimed to evaluate the long-term out-come of diaphragmatic plicatio n in adults with sympto-matic unilateral diaphragmatic paralysis for an average of 5 years.MethodsStudy...
- 7
- 395
- 0
Báo cáo y học: " Malignant melanoma of the stomach presenting in a woman: a case report" potx
... frequently asympto-matic character of gastrointestinal melanoma explainswhy it largely eludes detection. Symptoms includemainly gastrointestinal bleeding, abdominal pain, anor-exia, nausea and ... Arora AS: Metastatic malignant melanoma of the gastrointestinal tract. Mayo Clin Proc 2006,81(4):511-516.2. Basagoiti ML, Vesga F, Losada J, Villanueva-Edo A: [Gastric metastasis of melanoma. ]. ... andmaycreateamajordiagnosticchallengewhenpresent-ing at an intraabdominal location. The mean survivaltime of these patients is consistently less than one year. The exact clinical incidence of gastrointestinal mela-nomacannotbedeterminedfromanylargeseries,butthe...
- 4
- 351
- 0
Báo cáo y học: " Bronchiolar chemokine expression is different after single versus repeated cigarette smoke exposure" docx
... citation purposes)Respiratory ResearchOpen AccessResearch Bronchiolar chemokine expression is different after single versus repeated cigarette smoke exposureTomoko Betsuyaku*1, Ichiro Hamamura2, ... in bronchiolar expression of KC and MIP-2 over 24 hrs is different after single vs. repeated CS exposureFigure 6Kinetics in bronchiolar expression of KC and MIP-2 over 24 hrs is different after ... T, Hattori Y, Nishiyama Y, Yoshida A, Uchida K,Hiai H, Ochi H, Osawa T: Quantitative immunohistochemicaldetermination of 8-hydroxy-2'-deoxyguanosine by a mono-clonal antibody N45.1: its...
- 12
- 176
- 0
Báo cáo y học: " Dear vasopressin, where is your place in septic shock" pdf
... responding to conventional therapy [15].Therefore, institution of AVP infusion in advanced septic shock should not be guided by endocrinologic, but byhemodynamic indications!Whether the promising ... only in one-third of late septic shockpatients [12]. Additionally, the increase in arterial pressureduring AVP infusion occurs independently of plasma AVPconcentrations [9,13]. AVP therapy ... almost alwaysincreased in the initial phase of septic shock, and decreasedthereafter. Accordingly, the relative AVP deficiency andconsequently the suggested indication for AVP hormonereplacement...
- 2
- 224
- 0
Báo cáo y học: "Pro/Con debate: Is procalcitonin useful for guiding antibiotic decision making in critically ill patients" pdf
... and integration of clinical findings into decision- making processes.Patients with severe pancreatitis who developed infectivenecrosis or multiorgan dysfunction showed a sustainedincrease in ... identified[24], making the point that PCT is better used as a tool tostratify risk in the clinical context than specifically as a binaryindicator. A large epidemiological study is required in intensive ... results! The Danish Procalcitonin Study Group is conducting an RCT of a PCT-guided strategywith mortality endpoints in critically ill patients (NCT00271752)[26]. A French study is looking at another...
- 5
- 246
- 0
Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot
... AccessCommunity-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone NargisVoravit Suwanvanichkij1*, Noriyuki Murakami1, Catherine ... in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis. Conflict and Health 20104:8.Submit your next manuscript to BioMed Central and take full advantage ... limitations on international humanitarian assistance, particularly information gather-ing and travel for international staff, were a reality foraid o rganizations[60,61]. Community-led monitoring...
- 14
- 338
- 0
Báo cáo y học: "Medical emergency motorcycle – is it useful in a Scandinavian Emergency Medical Service?" docx
... versa. In this study theMEM assisted car ambulances in 17 instances of cardiacarrest and the MEM paramedic also assisted the car ambu-lance paramedics in other cases like carrying heavypatients ... CentralPage 1 of 4(page number not for citation purposes) Scandinavian Journal of Trauma, Resuscitation and Emergency MedicineOpen AccessOriginal research Medical emergency motorcycle – is it ... of medical emer-gency motorcycles (MEM) has been advocated. In a studyfrom Taiwan, Lin and co-workers demonstrated that a Published: 24 February 2009 Scandinavian Journal of Trauma, Resuscitation...
- 4
- 175
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenwhat is it like in a tropical rainforest ks2 wikipediafast is it useful in childrenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ