0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " High-Temperature unfolding of a trp-Cage mini-protein: a molecular dynamics simulation study" potx

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... have successfully expressed an active fusion protein of human CNTF and human soluble CNTF-R in mammaliancells. Hyper-CNTF has a calculated molecular mass of 60 kDa and apparent molecular mass ... enhanced interleukin-6 type pleiotropic activities. Eur.Cyt. Netw. 8, 359–365.36. Fukada, T., Hibi, M., Yamanaka, Y. , Takahashi Tezuka, M.,Fujitani, Y. , Yamaguchi, T., Nakajima, K. & Hirano, ... reflected by the activationpattern of STAT3 and MAP kinases, mainly p42, wereidentical for BAF/3 cells stimulated with Hyper-IL-6,Hyper-CNTF, and LIF.Analysis of the biological activity of Hyper-CNTF...
  • 9
  • 442
  • 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

... D., Abrams,D. & Yarranton, G.T. (1992) High-level expression of a recombinant antibody from myeloma cells using a glutaminesynthetase gene as an amplifiable selectable marker Biotechnology10, ... all the clones demonstrated that a sufficient amount of J-chain was available for SIgA complex formation. OneSIgA-producing clone (SIgA-3) along with pIgA-D andIgA-29 were analysed by SDS/PAGE ... Multiskan (ICN Flow, USA). The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration.Verification of J-chain expressionTo examine...
  • 6
  • 371
  • 0
Báo cáo y học:

Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

... Paracetamol(acetaminophen) hypersensitivity. Ann Allergy Asthma Immunol2000;85:508–11.38. Grant JA, Weiler JM. A report of a rare immediate reaction afteringestion of acetaminophen. Ann Allergy Asthma ... Patients with NSAID-Induced Urticaria/Angioedema 29ORIGINAL ARTICLEClinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/Angioedema: ... Szczeklik A. Adverse reactions to aspirin and nonsteroidal anti-inflammatory drugs. Ann Allergy 1987;57:113–8.9. Papa G, Romano A, Del Bono A, et al. Floctafenine: a validalternative in patients...
  • 7
  • 487
  • 0
Báo cáo y học:

Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

... students towards a psychiatry labelOlawale O Ogunsemi*, Olatunde Odusan and Michael O OlatawuraAddress: Olabisi Onabanjo University Teaching Hospital, Sagamu, Ogun State, NigeriaEmail: Olawale O ... waleogunsemi@yahoo.com; Olatunde Odusan - tunsan2001@yahoo.com; Michael O Olatawura - dareolatawura@yahoo.com* Corresponding author AbstractBackground: The aim of this study is to evaluate ... effect of a psychiatric label attached to anapparently normal person on the attitude of final year medical students at a Nigerian university.Methods: A questionnaire with sections on demographic...
  • 4
  • 347
  • 0
Báo cáo y học:

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... modulatedsuccessfully in case reports and small series, with apparentlylow acute toxicity [57,63]. Long-term safety data are needed.Scanty and sometimes contradictory AD animal data areavailable. Although ... hand, MSCs may also actively participate ininitiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immuneprivileged, they may under certain ... potentialorchestrators of bone and cartilage repair, it has becomeapparent in recent years that they may also have profoundimmunomodulatory effects. Around 70 people participated inthis 1-day...
  • 10
  • 559
  • 0
Báo cáo y học:

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... Base pairs ReferenceADAMTS-5 S: GGCATCATTCATGTGACACAS: GCATCGTAGGTCTGTCCTG364MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCACAS: CAGTGTTGGCTGAGTGAAAGAGACCC284Osteocalcin S: CATGAGAGCCCTCACAAS: AGAGCGACACCCTAGAC310 ... AGAGCGACACCCTAGAC310 [48]Alkaline phosphatase S: TGCAGTACGAGCTGAACAGAS: TGAAGACGTGGGAATGGTC267Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGAAS: CGCCCTGTTCGCCTGTCTCA25218S S: GAATCAGGGTTCGATTCCGAS: ... & Therapy Vol 9 No 1 Janelle-Montcalm et al.Page 4 of 9(page number not for citation purposes)Statistical analysisData are expressed as mean ± SEM or median (range). Statis-tical analyses...
  • 9
  • 351
  • 0
Báo cáo y học:

Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

... followed by biotinylated goat anti-rabbit IgG anti-body (Biospa, Milan, Italy) and streptavidin-alkaline phos-phatase (SAP) complex (Biospa, Milan, Italy). Fast Red TRSalt(Sigma-Aldrich, St ... biological active antibodyand cytokine moieties by binding assays on recombinant antigenand by MC/9 cell proliferation assays. We have alsocharacterized the ability of F8-IL10 to inhibit arthritis ... 6:2337-2342.17. Pini A, Viti F, Santucci A, Carnemolla B, Zardi L, Neri P, Neri D:Design and use of a phage display library. Human antibodieswith subnanomolar affinity against a marker of angiogenesiseluted...
  • 15
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: "Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite" doc

... acetyl-CoA carboxylase; 2, 3-oxoacyl-ACPsynthase; 3, 3-oxoacyl-ACP reductase; 4, 2-enoyl-ACP reductase; 5, methylmalonyl-CoA mutase; 6, methylmalonyl-CoA epimerase; 7, propionyl-CoA carboxylase; AAC, ... 3-hydroxyisobutyrate dehydrogenase; LC-ACS, long-chain acyl-CoA synthetase; MDH, malate dehydrogenase; OMC, oxoglutarate/malate carrierprotein; Pyr C, pyruvate carboxylase; SCS, succinyl-CoA synthetase; ... AAC, ATP/ADP translocator; ACP, acyl carrier protein; ALAT, alanine aminotransferase; BC-AAT, branched-chain amino acidaminotransferase; C I, complex I; ECH, enoyl-CoA hydratase; [Fe]-Hyd, [Fe]-hydrogenase;...
  • 16
  • 391
  • 0
Báo cáo y học:

Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

... 268:17083-17095.18. Barak D, Kronman C, Ordentlich A, Ariel N, Bromberg A, Marcus D, Lazar A, Velan B, Shafferman A: Acetylcholinesterase peripheral anionic sitedegeneracy conferred by amino acid arrays sharing ... Institute of NuclearEnergy Research. CC is a research fellow in the Depart-ment of Medical Research of Mackay Memorial Hospi-tal. HYL, WT, and YH are professors from NationalTaiwan University, National ... 49].Secondly, a molecule that satisfied all the features of thepharmacophore model used as the 3D query in datab asesearching was retai ned as a hit. Two database searchingoptions such as Fast/Flexible...
  • 13
  • 389
  • 0
Báo cáo y học:

Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx

... Compostela UniversityHospital. La Choupana, Santiago de Compostela 15706, Spain.2Department of Radiology, Santiago de Compostela University Hospital. La Choupana,Santiago de Compostela 15706, Spain.3Department ... Compostela UniversityHospital. La Choupana, Santiago de Compostela 15706, SpainFull list of author information is available at the end of the articleCereijo et al. Journal of Cardiothoracic Surgery ... Sierra Quiroga1, Anxo Martinez de Alegria2,Jose Manuel Suarez Peñaranda3AbstractBackground: As the population ages, bioprosthesis are increasingly being used in cardiac valve replacem...
  • 3
  • 370
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ