Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
... the majority of pediatric burn patientswas male, had suffered a flame burn injury and had 23% TBSA burn. Inhalation injury was present in 20% of all admittedburns.Respiratory failureRespiratory ... syndrome (ARDS), as defined clini-cally, diffuse alveolar damage (DAD) based solely on findingsat autopsy, aspiration or asphyxia, or asthma attack. ARDSwas clinically defined by meeting four ... 16% of all deaths. Anoxic brain injury accounted for 48% of the brain deaths after burn injury, while cerebral edema with herniation accounted for 52% of the brain deaths. The average TBSA was 62%...
- 7
- 265
- 0
Báo cáo y học: "The minimal kinome of Giardia lamblia illuminates early kinase evolution and unique parasite biology" docx
... below).Catalytically dead kinases In most kinomes, about 10% of kinases lack critical cata-lytic residues (K72, D166, D184) and are likely to be cat-alytically inactive, yet may retain signaling ... (Orf_14367) of adenylate and guany-late cyclases. No clear AKAP (A kinase anchoring pro-tein) was found. In many organisms, including Giardia,PKA localizes to the basal bodies/centrosomes [13]. In addition, ... by phosphorylation andpolyglycylation of the C-terminal tail. J Biol Chem 2006, 281:5137-5148.45. Anamika K, Bhattacharya A, Srinivasan N: Analysis of the protein kinome of Entamoeba histolytica....
- 20
- 491
- 0
Báo cáo y học: " The functional expression of extracellular calcium-sensing receptor in rat pulmonary artery smooth muscle cells" potx
... The CaSR isimportant in m aintaining and regulating mineral ionhomeostasis. Increasing evidence has indicated that CaSRwas functionally expressed in the cardiovascular system.Wang et al showed ... China.2Department of Pathophysiology, Harbin Medical University,Harbin 150086, PR China.3Department of Pharmacology, Har bin MedicalUniversity, Harbin 150086, PR China.4Bio-pharmaceutical ... staining. A cDNAfragment of 234 bp was found in cultured PASMCs, indi-cating the presence of CaSR mRNA in rat PASMCs.Western blotting analysis showed that CaSR was clearlyexpressed in rat...
- 8
- 350
- 0
Báo cáo y học: "The pathophysiological function of peroxisome proliferator-activated receptor-γ in lung-related diseases" pptx
... Tanahashi M, Yukiue H, Moiriyama S, Kobayashi Y, Nakashima Y, Kaji M, Kiriyama M, Fukai I, Yamakawa Y, Fujii Y: Decreased perioxisome proliferator-activated receptorgamma gene expression was ... purposes)nophil and lymphocyte influx may not be mediated bythe antagonism of the NF-κB pathway [31].Interleukin-5 (IL-5) is the principal regulatory cytokinemediating eosinophil airway inflammation and ... proteins, fatty acid metabolism andsubsequent pathways. Therefore, it is anticipated thatPPAR-γ expression will become a potential indicator of many airway inflammatory diseases leading to a possibleprevention...
- 9
- 262
- 0
Báo cáo y học: "The temporal program of peripheral blood gene expression in the response of nonhuman primates to Ebola hemorrhagic fever" ppsx
... (lanes B and D), day 2 after infection (lane E), day 3 after infection (lane F), day 4 after infection (lanes H and J), day 5 after infection (lanes L, N, and P), day 6 after infection (lane ... smears.Cytokine and chemokine ELISAsCytokine/chemokine levels in monkey sera/plasma wereassayed using commercially available ELISA kits according tomanufacturer's directions. Cytokines/chemokines assayedincluded ... symptoms appear. (b) Virus isolation from plasma. Infectious virus in EDTA plasma was assayed by counting plaqueson Vero cells maintained as monolayers in six-well plates under agarose, as...
- 14
- 601
- 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... on all abnormalities [12]. At present, in many ICUsCXRs are still routinely obtained on a daily basis, at least in TheNetherlands [13].There may be advantages to eliminating daily routine ... 22:1335-1338.9. Chahine-Malus N, Stewart T, Lapinsky SE, Marras T, Dancey D,Leung R, Mehta S: Utility of routine chest radiographs in a med-ical-surgical intensive care unit: a quality assurance survey.Crit ... involved in the design and statistical analysis of thestudy. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and...
- 7
- 722
- 0
Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf
... amplified by two primer pairs (CCR5-F1:5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1:5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2:5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2:5'AAGCCATGTGCACAACTCTGACTG3') ... including the mutation wasobtained by using primers CD45-F: 5'-GATTGACTACAG-CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT-TAAAAGCACTAGCA-3'; subsequent HpaII digestion of PCR products ... signifi-cantly associated with lower rates of HIV-1 infectionamong white individuals. Marmor et al [16], analyzing a large sample of individuals, found a protective role of CCR5-Delta 32 allele in uninfected...
- 4
- 384
- 0
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... reportDaisuke Yoshioka, Toshiki Takahashi*, Toru Ishizaka and Takuya HiguchiAbstractCardiac myxoma is the most common primary cardiac tumour, but infected cardiac myxoma is relatively rare.Infected ... toshiki@onh.go.jpDepartment of Cardiovascular surgery, Osaka National Hospital, 2-14Hoenzaka, Chuo-ku, Osaka city, Osaka, 540-0006, JapanYoshioka et al. Journal of Cardiothoracic Surgery 2011, 6:68http://www.cardiothoracicsurgery.org/content/6/1/68© ... diagnosis of aninfected myxoma in an atypical location. Am Heart J 1987, 113:1031-2.8. Veitch AM, Manghat NE, Kakani NK, Lewis CT, Ring NJ: Systemic septicembolisation secondary to an atrial myxoma...
- 4
- 543
- 0
Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"
... requiringsubstantial investments of additional resources. Academic centersare increasingly recognizing engagement in quality improvement as a distinct career pathway. Involving such physicians in ... thestandardized MET form on each patient and a weekly 1-hourCommentaryThe evolving story of medical emergency teams in qualityimprovementAndré Carlos Kajdacsy-Balla Amaral1 and Kaveh G Shojania21Department ... in medicalemergency teams will likely facilitate the dual roles of these as a clinical outreach arm of the intensive care unit and in identifyingproblems in care and leading to strategies to...
- 2
- 427
- 0
Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"
... reconstruction with cartilage grafts covered by axial, random and free flaps of temporoparietal fascia, ana-tomical researches of temporal area gained populari-ty.4 When its advantages are combined with ... face and scalp. In: Gray’s Anatomy The anatomical basis of clinical practice, 39th ed. Elsevier Churchill Livingstone; 2005: 497-519. 10. Mathes SJ, Nahai F. Regional Flaps: Anatomy and Basic ... Navarro-Ceballos R, Bastarrachea RA. Clinical applications of temporoparietal hair-bearing flaps for male pattern baldness and mustache formation. Aesthetic Plast Surg. 1991; 15(4):343-8. Int....
- 7
- 727
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcthe first law of thermodynamics states that energy in a system isbáo cáo y học cổ truyềnbáo cáo y tế học đườngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ