Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt
Báo cáo y học: "Collaboration between general hospitals and community health services in the care of suicide attempters in Norway: a longitudinal study" ppt
... attempt was markedly below the recommendations given in national standards. Systems at the hospital level for the management and care of patients admitted after a suicide attempt and systematic ... manuscript.Acknowledgements The study was supported by a grant from the Directorate of Health and Social Affairs, Norway.Mork et al. Annals of General Psychiatry 2010, 9:26http://www.annals-general-psychiatry.com/content/9/1/26Page ... in the CHS.Data on the number of inhabitants in each municipality and the degree of urbanisation of the municipality (rural,rural/urban or urban) were gathered from Statistics Nor-way. Information...
- 8
- 502
- 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... Huntsville,AL USA). The primer sequences used were: for β-actin, for- ward CCTTCGTGCCCCCCC and reverse GGAGAC-CAAAAGCCTTCATACATC; and for HMGB1, forwardATTGGTGATGTTGCGAAGAA and reverse GATCCACAG-CAACTCCAGAA. ... all patients and the study was approved by the local ethical committee at Karolinska University Hospital,Stockholm, Sweden. The median age of patients was 57 years (range 25 to 69years) and the ... collectedclinical patient data. ES and CG performed the immunohisto-chemical stainings and the immunohistochemical analysis. JLperformed the RT-PCR and mRNA analysis. ES, CG, UA and HEH prepared the manuscript....
- 8
- 529
- 0
Báo cáo y học: " An open letter to George M Philip, President of the State University of New York At Al" potx
... enlightening. Your classics faculty would gladly tell you about them, if only you had a Classics department, which now, of course, you don’t. As for the argument that the humanities don’t pay their ... virology programs. My second example you will probably be more familiar with. Middle Eastern Studies, including the study of foreign languages such as Arabic and Persian, was hardly a hot subject ... through, you will at least understand why.Just 30 days ago, on October 1st, you announced that the departments of French, Italian, Classics, Russian and eater Arts were being eliminated. You gave...
- 3
- 307
- 0
Báo cáo y học: "Human immunodeficiency virus infection and autoimmune hepatitis during highly active anti-retroviral treatment: a case report and review of the literature" potx
... informed consent was obtained from the patient for publicatio n of this case report and any accompany-ing images. A copy of the written consent is available for review by the Editor-in-Chief of ... office with fever and tachycardia and was hos-pitalized because of possible sepsis and acute abdomen.Her physical examination revealed that she was febrile(body temperature 102.1°F), tachycardic ... lymphoplasmacytic infiltrate and centrilobularhepatocellular necrosis caused by an acute chronicinflammatory infiltrate suggestive of autoimmune hepatitis.Daas et al. Journal of Medical Case Reports...
- 4
- 407
- 0
Báo cáo y học: " Renal cell carcinoma metastasizing to solitary fibrous tumor of the pleura: a case report" ppt
... spinal radiation therapy and gammaknife radiosurgery for brain metastasis. With metastaticdisease causing increased morbidity and no furthertreatment options available, t he patient was placed ... alternatinghypercellular and hypocellular areas and characteristicbranching, staghorn vessels which may captivate blood-borne metastases, as in the case of renal cell carcinomas. As a donor tumor, ... OL, De las Casas LE, Leon ME: Tumor-to-tumor metastasis. Renal cellcarcinoma metastatic to papillary carcinoma of thyroid: report of a case and review of the literature. Head Neck Pathol 2009,...
- 4
- 427
- 0
Báo cáo y học: "Patent abdominal subcutaneous veins caused by congenital absence of the inferior vena cava: a case report" pptx
... vena cava(IVC) are rare. Patients are usually asymptomatic and this developmental anomaly is detected incidentally dur-ing abdominal surgery or radiologic e valuation. Patentparaumbilical and ... subcardina l, and supracardinal veins. A normal IVC is composed of foursegments which are hepatic, suprarenal, renal and infrare-nal. Variation s of IVC anatomy are classified in a systembased on abnormal ... vena azygos and hemiazygos contin uation, and multiple liver veins emptying into the right cardiacatrium. We describe a rare case of abdominal subcutaneous wall veins as collaterals caused by a...
- 4
- 391
- 0
Báo cáo y học: "Patent abdominal subcutaneous veins caused by congenital absence of the inferior vena cava: a case report" potx
... Medicine,Heinrichstrasse 3 1a, A- 8010 Graz, Austria.Authors’ contributionsWJS and RWL conceived of and designed the study. WJS and PR analyzed and interpreted the data. WJS drafted the article and, along ... collateral veins are variable and, due to inadequate collateral circulation, this resultsin venous stasis and an increased risk of DVT.Congenital anomalies of the inferior vena cava aredescribed as ... veins: the posterior cardina l, subcardina l, and supracardinal veins. A normal IVC is composed of foursegments which are hepatic, suprarenal, renal and infrare-nal. Variation s of IVC anatomy are...
- 4
- 600
- 0
Báo cáo y học: "Proteinase-activated receptor-2: two potential inflammatory mediators of the gastrointestinal tract in Atlantic salmon" ppt
... 1316*PAR- 2a - PAR- 2a_ RACE_R1 TGGACTCCCCTGAAGATTGCCTACCAC 739*PAR-2b - PAR-2b_RACE_F1 CTGGACACCTCTGAAGATCGCCTACCAC 1655*PAR-2b - PAR-2b_RACE_R1 GCCCACCAGGACTTTACACAGCCT 687*PAR- 2a - PAR- 2a_ RT_F1 ... colonocytes is influencedby increased luminal proteinase activity rather than the release of proteinases such as tryptase [22]. Increasedluminal trypsin-like activity in the distal intestine of Atlantic ... however if the microbiota of Atlantic salmon fed feed containing SBM is altered as early as one day after feeding, and a putative involvement of bacteria in the early phases of the development of enteritismerits...
- 12
- 278
- 0
Báo cáo y học: " Facial herpes zoster infection precipitated by surgical manipulation of the trigeminal nerve during exploration of the posterior fossa: a case report" potx
... phenomenon, as well as the importance and role of prophylacticacyclovir in its management, are discussed.Case presentation: A 54-year-old Caucasian man with a classical long-standing left-sided V2 and ... fossa: a case reportNassir Mansour1, Chandrasekaran Kaliaperumal2* and Kishor A Choudhari1Addresses:1Department of Neurosurgery, Regional Neurosciences Unit, Royal Victoria Hospital, Belfast ... analyzed and revised the manuscript. All authors read and approvedfinal manuscript.AcknowledgementsWe thank the patient for his participation and kindapproval to share the details of his case for...
- 3
- 411
- 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... monomers for polymeriza-tion may play a critical role in actin filament assemblyin the actin patch. Binding of the LBD to Las17p mayalso stimulate Las17p-dependent activation of the Arp2 ⁄ 3 complex. ... actin-filament assembly in yeast cells. It hasalso recently been shown that human WASP–WIPinteraction is essential for human WASP to function-ally substitute for yeast WASP (Las17p) in yeast [55].Binding ... endocytosis, cytokinesis, and growth atelevated temperature, on the one hand, and in corticalactin-patch polarization, on the other hand, are at leastpartially distinct [23]. However, there may...
- 23
- 679
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenc and 13 c labelling of plant cell walls as a means of assessing ligno cellulose degradationbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo thành tích tập thể ngành y tếbáo cáo y tế học đường trường tiểu họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM