0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Results from the national sepsis practice survey: predictions about mortality and morbidity and recommendations for limitation of care orders" docx

Báo cáo y học:

Báo cáo y học: " Polysaccharides from the root of Angelica sinensis protect bone marrow and gastrointestinal tissues against the cytotoxicity of cyclophosphamide in mice

... the bone marrow and the gastrointestinal tissues from the cytotoxicity of CY in mice. We also profiled the changes of the expression of growth factors in gastric tissues in response to the damage ... sinensis protect bone marrow and gastrointestinal tissues against the cytotoxicity of cyclophosphamide in mice Marco K. C. Hui, William K. K. Wu, Vivian Y. Shin, Wallace H. L. So and Chi Hin Cho ... the protective effect of AP on CY-induced cytotoxicities in both the hemopoietic and gastrointestinal tissues was undefined. Any of these actions would extend the therapeutic application of...
  • 6
  • 655
  • 0
Báo cáo Y học: ORF6 from the clavulanic acid gene cluster of Streptomyces clavuligerus has ornithine acetyltransferase activity potx

Báo cáo Y học: ORF6 from the clavulanic acid gene cluster of Streptomyces clavuligerus has ornithine acetyltransferase activity potx

... for the biosynthesis of other clavams [13,14]. Thus, only functionsfor the gene products of orfs2–5 in the early stages of the pathway and the final stage (orf 9) of the clavulanic acid gene cluster ... clavuligerus .The orf6 gene of the clavulanic acid biosynthetic gene cluster inS. clavuligerus encodes a protein that shows sequencehomology to ornithine acetyltransferase (OAT), the fifthenzyme of the ... ORF6 from the clavulanic acid gene cluster of Streptomyces clavuligerus has ornithine acetyltransferase activity Nadia J. Kershaw1, Heather J. McNaughton1, Kirsty S. Hewitson1,...
  • 8
  • 509
  • 0
Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc

Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc

... 2002 Homopolymeric M-type T. bernacchii ferritin (Eur. J. Biochem. 269) 1603 Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer Guiseppina Mignogna1, ... Fanelli’,University of Rome ‘La Sapienza’, Italy Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is composed of a single subunit that contains both the ferroxidase center residues, typical ... ecchini, P. &Chiancone, E. (1996) The H -type ferritin from t he spleen o f the Antarctic teleost Gymnodr aco acutic eps . Proceedings of the ThirdMeeting on Antarctic Biology (Santa Margherita...
  • 7
  • 609
  • 0
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... (1983)Methylation analysis of complex carbohydrates in small amounts:capillary gas chromatography – mass fragmentography of meth-ylalditol acetates obtained from N-glycosidically linked glyco-protein ... 2002 Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b16)Man-motifsTomofumi Kurokawa1,2, Manfred Wuhrer2,Guă nter Lochnit2, Hildegard ... PNGaseA-PA and Hyd(HFA)-PA, respect-ively. Analytical anion-exchange HPLC of the pyridyl-aminated oligosaccharide pools demonstrated the absence of negatively charged oligosaccharide derivatives...
  • 15
  • 481
  • 0
Báo cáo y học:

Báo cáo y học: "What determines the evolution of early undifferentiated arthritis and rheumatoid arthritis? An update from the Norfolk Arthritis Register" ppt

... status,ReviewAspects of early arthritis What determines the evolution of early undifferentiated arthritis and rheumatoid arthritis? An update from the Norfolk Arthritis RegisterDeborah PM Symmons and Alan J ... unnecessaryrisk to give them intensive DMARD therapy or even biologictherapy. On the other hand, some patients do very badly and fail to respond to one DMARD after another. It would clearlybe useful ... badly. We have shown the benefits of startingdisease-modifying therapy early in the course of the disease. The fact that a greater proportion of patients are now treated early and with more effective...
  • 6
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: "Ultrasound has the potential to detect degeneration of articular cartilage clinically, even if the information is obtained from an indirect measurement of intrinsic physical characteristics" pdf

... system and the method to detect the early stage of degeneration of human articular cartilage. The signal intensity, considering tissue histology [4] andestimation of the mechanical property of ... charac-teristics of human cartilage in vivo is developed, we believeLetterUltrasound has the potential to detect degeneration of articular cartilage clinically, even if the information is obtained from ... intensity is valuable forclinicians who want to know the mechanism of degeneration of cartilage without performing a tissue biopsy. Until an ultra-sound system that can measure the intrinsic physical...
  • 2
  • 334
  • 0
Báo cáo y học:

Báo cáo y học: " Masitinib in the treatment of active rheumatoid arthritis: results of a multicentre, open-label, dose-ranging, phase 2a study" pdf

... sentinel of the syn-ovium, acting immediately in the event of joint trauma by liber-ating an array of proinflammatory mediators. However, MCsalso appear to perpetuate the chronic process by their ... and toanalysis and interpretation of the data. CDM, a medical writerat AB Science, contributed to data analysis and interpretationand was the main contributor in the preparation of the manu-script. ... tablets (AB Science,Paris, France), was administered orally in two daily intakes. Toevaluate the dose response of masitinib in DMARD-refractory active RA, dose ranging was performed by randomly assigningpatients...
  • 12
  • 471
  • 0
Báo cáo y học:

Báo cáo y học: " Learning from the U.S. Department of Veterans Affairs Quality Enhancement Research Initiative: QUERI Series Ian D Graham* and Jacqueline Tetroe" potx

... generalizability beyond the local context, and therefore should be eligible for research funding. The VA concept of QUERI Centers focused on aspecific patient population or condition and mandatedwith addressing ... bechallenging and confusing for the researcher and the studysetting by blurring the line between research and tradi-tional quality improvement initiatives. QUERI researchersneed to describe their ... and disappointments, the QUERI Series is all the moreuseful. From the vantage point of Canadian KT researchers and officials at a national health research funding agency, we offer a number of...
  • 6
  • 485
  • 0
Báo cáo y học:

Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

... CentralPage 1 of 3(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case reportMenstruating from the umbilicus as a rare case of primary umbilical endometriosis: ... of allcases of extragenital endometriosis. It usually occurs sec-ondary to surgical scars, but very rarely presents as pri-mary umbilical endometriosis [4,5]. We report one such rare case of ... consent was obtained from the patientfor publication of this case report and any accompanyingimages. A copy of the written consent is available forreview by the Editor-in-chief of this journal.Competing...
  • 3
  • 383
  • 0
Báo cáo y học:

Báo cáo y học: "Report from Mongolia – How much do we know about the incidence of rare cases in less developed countries: a case series" ppsx

... processes.Conclusion The global incidence of rare cases may be underestimatedby contemporary international databases. Diseases whichare currently considered to be rare in industrializednations may occur at a ... Central State University Hospital, Ulaanbaatar, Mongolia, 3Department of Surgery, Central State University Hospital, Ulaanbaatar, Mongolia and 4Department of Anesthesiology and Critical Care ... CentralPage 1 of 6(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case reportReport from Mongolia How much do we know about the incidence of rare cases in...
  • 6
  • 481
  • 0
Báo cáo y học:

Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

... identity and 66-70% aminoacid identity was found between the < /b> NS1 proteins. The< /b> NS allele A is more common and is the < /b> only subtypefound in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ ,resulting a product of 550 bp; and b- actin forward5’ TGGGTCAGAAGGACTCCTATG 3’ and reverse5’ AGAAGAGCTATGAGCTGCCTG ... [29-34]. The < /b> N-terminal RNA binding domain binds to < /b> both sin-gle- and double-stranded RNA that might inhibit the< /b> activation and/ or signalling of antiviral proteins, such asRIG-I, PKR, OAS/RNase L, activators...
  • 8
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: "Decrease in the incidence of total hip arthroplasties in patients with rheumatoid arthritis - results from a well defined population in south Sweden" doc

... denominator popula-tion of patients with RA is not defined. The aim of the present study was to investigate trends in the incidence of primary THA and TKA in a well defined sample of patients with ... 14.29THA, total hip arthroplasty. * Mean age for all observed patients in the cohort at the start of each calendar yearTable 3 Incidence of primary TKA during the study periodYear Mean age* Primary ... the study and the statistical analysis, and drafted the manuscript. LJ participated in the design of the study and in the analysis and interpretation of data. J-ÅN participated in the design of the...
  • 6
  • 462
  • 0
Báo cáo y học:

Báo cáo y học: "Results from the national sepsis practice survey: predictions about mortality and morbidity and recommendations for limitation of care orders" docx

... percentile of the estimated mortality predictions (inclusive of 90% of respond-ents) for each vignette as a measure of the variability in these predictions. The unit of analysis for all results was the ... predictions about mortality and mor-bidity vary widely.ã Older age, high BMI, and early-stage lung cancer are associated with poorer predictions of mortality and mor-bidity, independent of ... subsequent care and outcome [6-8]. The patient and provider factors that color the information provided by ICU physicians are largelyunknown. By better understanding these factors, it may allow for the...
  • 11
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Highlights from the Critical Care Canada Forum 2009 – 25 to 28 October 2009, Toronto, Ontario, Canada" pot

... LtdHighlights from the Critical Care Canada Forum 2009 25 to 28 October 2009, Toronto, Ontario, Canada Iain J McCullagh1 and Damon C Scales2MEETING REPORT*Correspondence: Damon.scales@sunnybrook.ca2Department ...  e Critical Care Canada Forum was held in Toronto, Canada from 25 to 28 October 2009 [1].  e conference, which focuses on the care of critically ill patients wherever the patients ... interval = 28. 9 to 55.0%).Together, these presentations highlighted the potential importance of early treatment with neuraminidase inhibi-tors. Following the session, 240 of the Critical Care Canada...
  • 2
  • 231
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP