Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx
Báo cáo y học: "Early down-regulation of the pro-inflammatory potential of monocytes is correlated to organ dysfunction in patients after severe multiple injury: a cohort study" pptx
... intracellular cytokine synthesis by monocytes within the first 24 hours after traumaSevere multiple injury results in a rapid decline of intracellular cytokine synthesis by monocytes within the first ... and in risk adjustment as well as a monitoring device at the bedside.It seems reasonable to assume that the intensity of monocytictemporal paralysis, that is, the diminished capacity to releaseproinflammatory ... cell types may vary after trauma, especially from patient to patient, according to the severity of injury. In our opinion, to date the sole determi-nation of cytokines in whole blood or in the...
- 11
- 301
- 0
Báo cáo y học: "Advanced glycation end-product (AGE)-damaged IgG and IgM autoantibodies to IgG-AGE in patients with early synovitis." ppt
... of the early synovitis patients are shown in Table 1. A total of 105 patients met the American College of Rheumatology criteria for RA. Of the patients meeting American College of Rheumatology ... duration less than 1 year. Patients wereevaluated clinically and serologically, and radiographs wereobtained at initial and 1-year visits. Sera were assayed for IgG-AGE and anti-IgG-AGE antibodies ... arthritis.Table 5AGE-IgG is associated with the inflammatory response, whereas anti-AGE-IgG is associated with rheumatoid factor positiverheumatoid arthritis in the early synovitis cohort at the...
- 9
- 262
- 0
Báo cáo y học: "Does eGFR improve the diagnostic capability of S-Creatinine concentration results? A retrospective population based study" ppsx
... m2)). Since the calculated uncertainty corresponds to an intralaboratory uncertainty it is an underestimate of the interlaboratory uncertainty that should be the basis for a recommendation. The ... uncertainty of S-Creatinine is about 14 µmol/L or one third. Therefore the use of MDRD-eGFR in diagnosis may be misleading and the large uncertainty is a disadvantage in monitoring. The ROC data ... participation in UK NEQAS. The laboratory reports a measurement uncertainty of 5 %. The laboratory was accredited according to CPA (UK). Since there is no prerequisite in the guidelines that laboratories...
- 9
- 348
- 0
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
... antigen of antineutrophil cytoplasmicantibodies with a cytoplasmic staining pattern (c-ANCA) in Wegener’s granulomatosis (WG). The WGdisease appears as severe vasculitis in different organs (e.g. ... APAAP = alkaline phosphatase–antialkaline phosphatase; c-ANCA = antineutrophil cytoplasmicantibodies with a cytoplasmic staining pattern; PR-3 = proteinase-3; WG = Wegener’s granulomatosis; RT-PCR ... One of the unresolved issues is the inability to explain the nonrandom, selected organ injury that defines the WG vasculitis and the concurrent, seemingly random,nature of injury within ‘targeted’...
- 7
- 370
- 0
Báo cáo y học: "Chordin knockdown enhances the osteogenic differentiation of human mesenchymal stem cells" pdf
... mRNA analysis), 10days (for mRNA analysis and ALP assay), and 21 days (for cal-cium deposition assay). After 3 and 10 days of culture, totalRNAs were extracted from the human MSCs. RT-PCR analy-sis ... basis of the expression of alkaline phosphatase (ALP)activity and incorporation of calcium in the extracellular matrix. The deposition of a mineralized matrix was further examined bystaining ... Recombinanthuman BMP-2 and BMP-7 are used clinically in spinal fusionand the healing of tibial fractures. To obtain a clinically accept-able result, these proteins are used at wildly supraphysiologi-cal,...
- 9
- 404
- 0
Báo cáo y học: "Epidemiology, costs, and the economic burden of fibromyalgia" pptx
... Sicras-Mainar and colleagues reported data frommedical practice in a multicenter primary care setting in Spain, covering a primarily urban population [1]. The studyanalyzed the incremental costs of ... adequate evidence supporting these feelingsfor FM overall is missing.There are few data on the costs of FM and the data differ. The approaches range from analyzing large databases to focusing ... back pain, and €3,205 for ankylosingspondylitis – the latter amount was calculated prior to the approval of biologicals for the treatment of ankylosingspondylitis [8]. The study from Sicras-Mainar...
- 2
- 285
- 0
Báo cáo y học: " Foot posture influences the electromyographic activity of selected lower limb muscles during gait" doc
... placed on the plantar surface of the interphalangeal joint of the halluxand the most posterior plantar aspect of the calcaneus to record the timing of heel contact, toe contact, heel off andtoe ... truncated, CIA calcaneal inclination angle, C1MA calcaneal first metatarsal angle, TNCA talo-navicular coverage angle, T2MA talus-second metatarsal angle.FCdenotes the number of participants ... coverageangle, calcaneal inclination angle and calcaneal-first met-atarsal angle) [16]. To qualify for the normal-arched footgroup, participants had either a normal arch index ornavicular height...
- 9
- 322
- 0
Báo cáo y học: "Early Differential signaling mechanisms regulate expression of CC chemokine receptor-2 during monocyte maturatio" ppsx
... 5'GAAACTCCAAACACCACAGAGGACCCR1 antisense 5'TTCGTGAGGAAAGTGAAGGCTGCCR2 sense 5'CCACATCTCGTTCTCGGTTTATCAGCCR2 antisense 5'CGTGGAAAATAAGGGCCACAGCCR3 sense 5'CACTAGATACAGTTGAGACCTTTGGCCR3 ... 5'CACTAGATACAGTTGAGACCTTTGGCCR3 antisense 5'GGTAAAGAGCACTGCAAAGAGTCCCR4 sense 5'ACCCCACGGATATAGCAGATACCCCR4 antisense 5'CGTCGTGGAGTTGAGAGAGTACTTGCCR5 sense 5'GGAGCCCTGCCAAAAAATCCCR5 ... antisense 5'GTATTGGCAGTGGGTGGCGCXCR4 sense 5'AGTATATACACTTCAGATAACCXCR4 antisense 5'CCACCTTTTCAGCCAACAGCXCR5 sense 5'CTGGACAGATTGGACAACTACXCR5 antisense 5'CATCACAACAACTCCCTGAGAPDH...
- 14
- 285
- 0
Báo cáo y học: " Pericardial effusion as the only manifestation of infection with Francisella tularensis: a case report" pps
... differential diagnosis.IntroductionTularemia, caused by the facultative intracellular Gram-negative bacterium Francisella tularensis, is endemic in cer-tain areas of the northern hemisphere. In France, ... the analysis of bacterial tests and in writing a first draft, PYL participated in collecting the dataand in following the patient's case, and contributed to the discussion, GH participated ... non-lethal, F. tularensis spp. holarctica (biovar type B) maycause severe disease, and in the case of delay of appropri-ate therapy, the course may be long-lasting and compli-cated.Published: 13...
- 3
- 269
- 0
Báo cáo y học: " Paper reports overview: The many guises of respiratory support, microalbuminuria and delirium" pdf
... chemistry A pilot study by Abid and colleagues has demonstrated thatan increasing urinary microalbumin over the first 48hours of ICU admission appears to accurately predict the evolution of acute ... months have seen a variety of important andthought provoking studies published.Respiratory medicineFebruary saw the publication of the large scale AustralianALI/ARDS epidemiology study [1] ... colleagues have aided identification andstandardisation of this problem by designing and validating anassessment system (see paper report) [12]. An interestingpaper on the antioxidant effects of...
- 2
- 264
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyeninatomi t sotozono c amemiya t kanamura n kinoshita s 2004 transplantation of cultivated autologous oral mucosal epithelial cells in patients with severe ocular surface disorders br j ophthalmol 88 1280 1284báo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ