Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
Báo cáo y học: "Are chiropractors in the uk primary healthcare or primary contact practitioners?: a mixed methods study" docx
... primary healthcare or primary contact practitioners?: a mixed methods studyAmanda R Jones-HarrisAbstractBackground: One of the debates regard ing the role of chiropractors is whether or not they ... chiropractors as primary healthcare practitioners, each pertaining to a different aspect of primary healthcare .Therespon-dents were in agreement that when the term primary healthcare is applied ... LA, Fryer GE: Chiropractors are not a usualsource of primary health care. Am Fam Physician 2004, 69(11):2544.15. American Academy of Family Physicians: Policy & Advocacy: Primary Care.2008...
- 12
- 523
- 0
Báo cáo y học: "Inflammatory changes in the airways of mice caused by cigarette smoke exposure are only partially reversed after smoking cessation" docx
... emphysema, includeddetermination of the averag e inter-alveolar distance, wasestimated by the mean linear intercept (Lm) analysis. The Lm was determined by light microscopy at a totalmagnification ... to investigate the effect of smoking cessation on airway remodeling andpulmonary inflammation. The severity of airway remo-deling and inflammation was studied by determiningalveolar enlargement, ... Migra-tion and activation of inflammatory cells to the lung isregulated by the release of different mediators, includingproteases, cytokines and chemokines secreted by a vari-ety of inflammatory and...
- 11
- 432
- 0
Báo cáo y học: "Structural features in the Rous sarcoma virus RNA stability element are necessary for sensing the correct termination codon" potx
... CGAAACTAGTCCCTCNCTA-TAAATTTGTC AAGCGGPTC at 1250AatII UAGN for CGCATGACGTCTAGNATCTAATGAGAGEagI UAGG rev CGAACGGCCGCCCTCGCTATAAATTTGTCAAGCGGPremature termination codons were introduced into ... GTGGCCCCTCCCT[TAGG]GTAAACTTGTAGCGCTAACGCQCPTC2631 CGCAATTAGTGGAAAAAGAATTA[TAGG]TAGGACATATAGAACCTTCACTTAGTTGTTGGQCPTC2685 GAACACACCTGTCTTCGTG[TAGG]GGAAGGCTTCCGGGQCPTC2736 CATGATTTGCGCGCTGTT[TAGG]CCAAGCTTGTTCCTTTTGGAbbreviationsRSV: ... GTCAAGCGGEagI UGAN rev CGAACGGCCGCCCTCNTC A- TAAATTTGTC AAGCGGEagI UAGN rev CGAACGGCCGCCCTCNCT A- TAAATTTGTCA AGCGGGag stop codon with ΔRSEAatII WT for CGCATGACGTCACGAATCTAATGAGAGSpeI UAGN...
- 15
- 396
- 0
Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt
... pi120, appeared initially at the 2 minutetime point showing that RH /IN and RT/RH cleavage occurrelatively early in the processing cascade. The later andBioMed CentralPage 1 of 6(page number ... cleaved at rates that vary up to 400-fold in vitro [9,13]. Initial cleavage occurs at the p2/NCsite followed by an intermediate rate of cleavage at the MA/CA and p1/p6 sites, and final cleavage at ... further suggest that early dimerization of the PR and RT domains may serve as a regulatory element to influence the kinetics of processing within the Pol domain.Findings The retroviral protease...
- 6
- 353
- 0
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"
... withadvanced cancer and pain. J Pain Symptom Manage 2002,23:526-532.83. Khojainova N, Santiago-Palma J, Kornick C, Breitbart W, GonzalesGR: Olanzapine in the management of cancer pain. J PainSymptom ... anticoagulant and cardiovascularmedications. Olanzapine may induce or worsen cardiacrisk factors such as obesity, metabolic derangements andhyperlipidemia. Quetiapine and risperidone may alsocontribute ... lipid-lowering agents, as well as risk ofbleeding complications when taken with antiplateletagents, warfarin or niacin. Carbamazepine acts as aninducer of cytochrome 3A4 , which may increase the metabolism...
- 10
- 709
- 0
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"
... that are capable of inducing muta-tions and initiating carcinogenesis. The capacity to repair DNA damage induced by activated carcinogens appears to be one of the host factors that may influ-ence ... may be always a possible limitation of combining data from various sources as in a meta-analysis. The idea of ad-justing the results of meta-analyses for publication bias and imputing "fictional" ... required for NER and is involved in the DNA damage recognition process. Both RPA and XPA preferentially bind damaged DNA, and because RPA and XPA di-rectly interact in the absence of DNA, the RPA-XPA...
- 13
- 711
- 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
... Afterits activation, different secondary pathways can occur:adenylate cyclase catalyses the formation of cAMP,whereas phospholipase C hydrolyses membrane phospha-tidylinositol, liberating inositol ... 1,4,5-triphosphate (InsP3)and diacylglycerol. Although cAMP and InsP3cascadesappear to be active as two alternative pathways in vertebrate olfaction [7], mechanisms of olfactory signaltransduction in ... analysis of the 3¢ end cDNArevealed that there is a polyadenylation signal upstream of the poly (A) .Analysis of the primary structure ofM. brassicaeGqa The putative protein product encoded by the...
- 10
- 619
- 0
Báo cáo y học: "Treating rhinitis in the older population: special considerations" pdf
... rhinitis may be caused on rare occasionsby organisms such as Klebsiella ozaenae. Secondaryatrophic rhinitis may result from nasal surgery, particu-larly from turbinectomy performed for nasal ... atreconstituting support for the nasal upper lateral cartilageand elevating the drooping nasal tip. Removal of tur-binate mucosa should be avoided, especially when exces-sive dryness is already a factor ... seen in the eld-erly. Atrophy and crusting of the nasal mucous membraneoccur with resorption of the underlying bone. The crust-ing may result in an unpleasant odor called ozena [11]. Primary atrophic...
- 4
- 465
- 0
Báo cáo y học: "Physical anhedonia in the acute phase of schizophrenia" doc
... a "cardinal symptom"preceding and possibly causing schizophrenia.According to Chapman et al [7], there are two types ofanhedonia, physical anhedonia and social anhedonia.Physical ... Physical Anhedonia Scale, PANSS: Positive and Negative Syndrome Scale, EPSE: Rating Scale for Extrapyramidal Side-Effects, BARS: the Barnes Akathisia Rating Scale, AIMS: Abnormal Involuntary Movement ... EPSE and the third using the BARS. Information from the patient's his-tory, concerning social-demographic and clinical parame-ters was recorded in a pre-coded interview form. The antipsychotic...
- 5
- 367
- 0
Báo cáo y học: "Tissue engineering in the rheumatic diseases" ppsx
... Wakitani S, Aoki H, Harada Y, Sonobe M, Morita Y, Mu Y, TomitaN, Nakamura Y, Takeda S, Watanabe TK, Tanigami A: Embryonicstem cells form articular cartilage, not teratomas, in osteo-chondral ... ethical concerns, easy dataprocessability and reproducibility, and automatization andstandardization [12]. The increasing prevalence of cartilage destruction in OA andRA has entailed an intensified ... distribution.Remaining PLGA fibers appeared red. (c) After 4 weeks, matrixformation was demonstrated by alcian blue staining of cartilageproteoglycans and by antibody staining of (d) collagen type I and(e)...
- 11
- 397
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenthey are important in the research of material response because they provide a link between mechanical behaviour and physical structure of the materialbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP