Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot

... (65.5%).Dermatophagoides pteronyssinus (Dpt) was the causativeallergen in 62, Dermatophagoides farinae (Df) in 58, cathair dander in 23 and dog hair dander in 9 patients (some patients were allergic ... because C3 and C4 levels were within thenormal range in all patients tested (Table 1). In support of the lack of involvement of the classical and lectin comple-ment pathways is the study by ... infants at high risk of asthma. Lancet 2000, 13(355(9216)):1680-1683.21. Andersson M, Laukkanen M, Salkinojasalonen M: 3-Hydroxy fattyacids: Stable indicators of endotoxin in hay and straw dust.Journ...

Báo cáo y học: "Circulating immune complexes contain citrullinated fibrinogen in rheumatoid arthritis" ppt

... candidateautoantigens in RA, including protein and overlapping pep-tides representing native and citrullinated fibrinogen. Synovialmicroarray analysis demonstrated targeting of citrullinatedfibrinogen ... Kurokawa T, Hara S, Takahara H, Sugawara K, Ikenaka T: Conver-sion of peanut trypsin-chymotrypsin inhibitor B-III to a chymo-trypsin inhibitor by deimination of the P1 arginine residues in two ... counter-stained with haematoxylin and eosin.StatisticsAll statistics were run using InStat™ software (GraphPad Soft-ware Inc., San Diego, CA, USA). For quantitation of ICs and autoantibodies...

báo cáo khoa học:" Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial" pot

... hydroxyl radicals that cause damage toprotein, RNA and DNA that are not repairable by cellularmechanisms thus initiating the malignant process Gradual increase of copper levels from precancer ... Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trialSunali S Khanna*1 and Freny R Karjodkar2Address: 1Department of Oral Medicine and Radiology, ... relevance of immune complexes associated antigen and antibody in can-cer. In Immune complexes and human cancer Penguin Publishing Corp;1985:62. 23. Deshpande VA, Jussawalla DJ: Evaluation of cancer...

Báo cáo y học: "Circulating surfactant protein -D is low and correlates negatively with systemic inflammation in early, untreated rheumatoid arthritis" pps

... GLdrafted the manuscript. KJ carried out the immunoassays and gel filtrationchromatography. AGJ and AV evaluated the x-ray data. All authors read and approved the final manuscript.Competing interestsThe ... inverse associationbetween SP-D and disease activity measures and by thegradual SP-D increase during treatment. The inverseassociation of SP-D and inflammatory signs and the lack of association between ... < 2.6 after four years.Including patients with radiographs available at bothbaseline and after four years (N = 133), 53%, 23% and 49% progressed radiographically according to TSS, JSN and ES...

Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx

... forward: ACCCAGAAGACTGTGGATGG;GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, for-ward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse:GCTCACAAGAACAGACTTTCCAG; and RANKL, forward:CCAAGATCTCCAACATGACT; and ... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteo-clastogenesis by ectodomain shedding of receptor activator of NF-kappa ... (Geneworks, Adelaide, SA, Aus-tralia), in accordance with the manufacturer's instructions.RANKL, OPG, and glyceraldehyde phosphate dehydrogenase(GAPDH) mRNA expression was analyzed by real-time...

Báo cáo y học: "The human urinary proteome contains more than 1500 proteins, including a large proportion of membrane proteins" pptx

... methio-nine and protein N-acetylation and deamidation of asparag-ine and glutamine were searched as variable modifications.Initial mass tolerances for protein identification on MS peakswere ... compoundsGlycosaminoglycan bindingPolysaccharide bindingHydrolase activity, acting on glycosyl bondsGTPase activityPattern bindingSerine-type endopeptidase activityElectron transporter activitySugar bindingLipid ... samples 1 and 2, and pooled sample).Origin of proteins in the urineOur analysis revealed that extracellular proteins, plasmamembrane proteins, and lysosomal proteins are enriched in the urine,...

Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc

... base excess; creatinine [mg/dl]; AST [U/l]: aspartate aminotransaminase; ALT [U/l]: alanine aminotransaminase; CK [U/l]: creatine phosphokinase; CK-MB [U/l]: „MB"-type isoenzyme of creatine ... was in charge of he statistical evaluation. MSchconceived of the study, and participated in its design and coordination and draft the manuscript. All authors read and approved the final manuscript.AcknowledgementsThis ... tissue infiltration and tissue damage.BackgroundHemorrhagic shock is a leading cause of complications and death in combat casualties and civilian trauma [1]. Ithas been shown to cause systemic inflammatory...

Báo cáo y học: "Circulating adenosine increases during human experimental endotoxemia but blockade of its receptor does not influence the immune response and subsequent organ injury" pdf

... range]) and were analyzed with one-way analysis of variance (ANOVA). The probability values refer to the significant increase in circulating cytokines for each group, as analyzed with repeatedmeasures ... resulted in a markedincrease in the urinary excretion of markers of proximal and distaltubular damage. Data are expressed as percentage increase in timeafter LPS infusion (median [interquartile range]). ... [19].Statistical analysisData with a Gaussian distribution were tested for signifi-cance by using repeated measures analysis of varian ce(ANOVA). Non-parametric data were analyzed with theRamakers et al....

Báo cáo y học: "Neural immune pathways and their connection to inflammatory diseases" ppsx

... associated with increasedsusceptibility to autoimmune/inflammatory disease in a variety of animal models and human studies. In general, atthe baseline the HPA axis parameters do not differ in indi-viduals ... Delgado M, Abad C, Martinez C, Juarranz MG, Arranz A, GomarizRP, Leceta J: Vasoactive intestinal peptide in the immune system: potential therapeutic role in inflammatory and autoimmune diseases. ... Demitrack MA, Crofford LJ: Evidence for and pathophysiologicimplications of hypothalamic–pituitary–adrenal axis dysregu-lation in fibromyalgia and chronic fatigue syndrome. Ann N Y Acad Sci...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP