0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf

Báo cáo y học:

Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf

... here is most valuable as a tool for high-throughput evaluation of new CCR5 and CXCR4 inhibitors and in vitro evaluation of their therapeutic potential in combination anti -HIV therapy.Materials and ... T-cell- line- adapted HIV- 1. Nature 1996, 382:833-835.18. Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, ... sequential addition of CXCR4- and CCR5- directed chemokines. TheU87.CD4 .CCR5. CXCR4 cell line reliably supported HIV- 1 infection of diverse laboratory-adaptedstrains and primary isolates with varying...
  • 13
  • 395
  • 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... Sequence analysis of the Drosophilagenome has already demonstrated that it contains 32 ugtgenes [44]. Biochemical evidence and comparisons withmammalian systems point to a range of important functions for ... UDP-glycosyltransferase.The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role in the detoxication and elimination of a wide range of endogenous and exogenouscompounds. ... accession number AF324465.Analysis of gene expressionB. mori (Shuko · Ryuhak u) eggs were obtained fromKatakura Kogyo (Matsumoto, Japan), and the larvae werereared on an artificial diet as d escribed...
  • 7
  • 470
  • 0
Báo cáo y học:

Báo cáo y học: "Demonstration of a novel technique to quantitatively assess inflammatory mediators and cells in rat knee joints" pps

... discussion 1066.4. Chang H, Israel H: Analysis of inflammatory mediators in tem-poromandibular joint synovial fluid lavage samples of symp-tomatic patients and asymptomatic controls. J Oral ... cells into the synovial tissue and joint space is another key characteristic of synovitis, which combinedwith release of these mediators and degradative enzymes,eventually leads to cartilage and ... AbstractBackground: The inflammation that accompanies the pain and swelling associated with osteo- and rheumatoid arthritis is mediated by complex interactions of inflammatory mediators. Cytokinesplay...
  • 8
  • 403
  • 0
Báo cáo y học:

Báo cáo y học: "Upregulation of a novel eukaryotic translation initiation factor 5A (eIF5A) in dengue 2 virus-infected mosquito cells" pot

... T, Nakamura Y, Nakamura F, Shirakura T, Adachi J, Goto N,Okamoto K, Hasegawa M: Protein phylogeny gives a robust estimation for early divergences of eukaryotes: phylogenetic place of a mitochondria-lacking ... Science, Waltham, MA, USA) and exposure to K odak BioMax XAR film (Eastman Kodak, Rochester,NY, USA).Statistical analysisComparisons between two means were analyzed by Stu-dent’s t-test at a significance ... (hpi) to detect RNA synthesis throughamplification of a gene fragment by RT-PCR. The pri-mer pair (D2EL: TAACACCACAGAGTTCC ATC and D2ER: TAAACTTTCCTGTGCACATA) was used to detect ne wly synthesized...
  • 9
  • 240
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc

... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1411-1575 165F2-3 TGCAGGGATCCATGAATGACGACCAGTTAGAT GTCGACTTAAGCTAATGGTCCAGTAGA 1531-1731 201F4 TGCAGGGATCCATGAATGACGACCAGTTAGAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT ... TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1558-1575 18F13GATCCATGATCTATTATCCGGGGTAAG TCGACTTACCCCGGATAATAGATCATG 1558-1572 15F14GATCCATGTATTATCCGGGGGAATAAG TCGACTTATTCCCCCGGATAATACATG ... TGCAGGGATCCATGGACGACCAGTTAGATGGT CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1534-1575 42F6 TGCAGGGATCCATGCAGTTAGATGGTGACAAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1540-1575 36F7 TGCAGGGATCCATGTTAGATGGTGACAATATC...
  • 9
  • 450
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of a novel betaherpesvirus in Mus musculus" docx

... and anotherPCR analysis was performed using the same primers as inthe initial analysis. DNA of organs and tissue supernatantswas extracted using the QiAamp tissue kit according to themanufacturer's ... DNA polymerase and glycoprotein B genes revealed a 3.4 kb sequence that was similar to sequences of rodentcytomegaloviruses. Pairwise sequence comparisons and phylogenetic analyses showed that ... rooted phylogram is shown, with HHV- 6a as outgroup. The branch length is proportional to evo-lutionary distance (scale bar). Results of bootstrap analysis (1000 replicates) are indicated at the...
  • 4
  • 281
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization of a novel and spontaneous mouse model of inflammatory arthritis" pptx

... Mimori T, Matsuda F, Iwamoto T, Momohara S, Yamanaka H,Yamada R, Kubo M, Nakamura Y, Yamamoto K: A regulatory variant inCCR6 is associated with rheumatoid arthritis susceptibility. Nat Genet2010, ... at early and late stages of disease. Serum was isolatedfrom AR and NAR littermates, and the levels of six cytokines were measured by cytometric bead array. Only (A) IL-6 and (B) TNF -a weredetected. ... contributionsIA conducted the cytokine CBA assays and the majority of the flowcytometry. JW was critical in compiling and analyzing the clinical data,performed most of the Ig ELISAs and designed and...
  • 18
  • 383
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization of a novel and spontaneous mouse model of inflammatory arthritis" doc

... strain as a new murine model of infl ammatory, possibly auto-immune, arthritis.  e IIJ strain is similar both histologically and serologically to RA and other murine models of auto immune arthritis. ... as: Cuzzocrea S: Characterization of a novel and spontaneous mouse model of in ammatory arthritis. Arthritis Research & Therapy 2011, 13:126.Cuzzocrea Arthritis Research & Therapy ... 191:313-320.7. Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP-70...
  • 3
  • 271
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps

... Tax2Toshiyuki Shoji†1,2, Masaya Higuchi†1, Rie Kondo1, Masahiko Takahashi1, Masayasu Oie1, Yuetsu Tanaka3, Yutaka Aoyagi2 and Masahiro Fujii*1Address: 1Division of Virology, Niigata ... Masahiko Takahashi - masahiko@med.niigata-u.ac.jp; Masayasu Oie - moie@med.niigata-u.ac.jp; Yuetsu Tanaka - yuetsu@s4.dion.ne.jp; Yutaka Aoyagi - aoy@med.niigata-u.ac.jp; Masahiro Fujii* - fujiimas@med.niigata-u.ac.jp* ... http://www.retrovirology.com/content/6/1/83Page 11 of 11(page number not for citation purposes)25. Iwanaga Y, Tsukahara T, Ohashi T, Tanaka Y, Arai M, Nakamura M,Ohtani K, Koya Y, Kannagi M, Yamamoto N, Fujii...
  • 11
  • 548
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of a novel resistance (E40F) and compensatory (K43E) substitution in HIV-1 reverse transcriptase" doc

... susceptibility and replicative capacity.Results: A large database (Quest Diagnostics database) was analysed to determine theassociations of the E40F and K43E changes with known resistance mutations. ... 43E-RT (5' ACA GAG CTG GAA GAGGAA GGG AAA A- 3', nucleotides 2664–2688) and 43E-RTA (5' ACA TTT CTG GAA GAG GAA GGG AA-3', nucle-otides 2664–2686) were used. To delete the ... (NRTI)treatment for several reasons. They can reduce susceptibil-ity to particular drugs and/ or they can act as compensatorymutations by improving the viral replication capacity(RC). Alternatively,...
  • 11
  • 289
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ