Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgat-gctctaccgactgagctatccgggc 3' (tRNALys,3);2. 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg ... aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and 5' tgccccgtgtgaggatcgaactcacg accttcagattatgagact-gacgcgctacctactgcgctaacgagg 3 (tRNAMet(e));3. 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg3' and 5' ... gtttccctttcgctttcagaaccatcctctgctaccactgctagagattttcc 3'5' ggaaaatctctagcagtggtagcagagggtggttctgaaagcgaaag-ggaaac 3' Met(i) AG5' gtttccctttcgctttcagaaccaccctctgctaccactgctagagattttcc...
- 14
- 189
- 0
Báo cáo y học: " Analysis on the clinical features of 22 basaloid squamous cell carcinoma of the lung" doc
... carcinomacases and 102 from PDSC cases. One of the 19 basaloidsquamous cell carcinoma sections had a pure basaloidpattern and was reclassified as a variant of a large cellcarcinoma. Additionally, of ... 2010 Accepted: 26 January 2011Published: 26 January 2011References1. Kawashima O, Kamiyoshihara M, Sakata S, Kurihara T, Ishikawa S, Morishita Y: Basaloid carcinoma of the thymus. Ann Thorac ... ultrastructuralfeatures of basaloid carcinoma of the lung [4]. Of the 38cases analyz ed, basaloid carcinoma of the lung was purein 19 cases, and had a well-differentiated squamous cellcarcinoma...
- 6
- 400
- 0
Báo cáo y học: " Alterations in the expression of DEAD-box and other RNA binding proteins during HIV-1 replication" potx
... the data were subjected to statistical analyses using univariate parametric and multivariate permutation analyses, based on the one sam-ple random variance t-statistic, where significance wasbased ... members of the helicase family at the ATP binding site [31], indicat-ing that many ATP-dependent processes may be targetedby early viral replication steps, not only as a means to facilitate viral RNA ... RNA isolation, and microarray labeling and hybridization methods are contained in reference [9]. Fol-lowing microarray data acquisition, data were analyzedusing commercial (GenePix Pro software,...
- 5
- 255
- 0
Báo cáo y học: " Polysaccharides from the root of Angelica sinensis protect bone marrow and gastrointestinal tissues against the cytotoxicity of cyclophosphamide in mice
... adversely affect the repairing capacity and the defensive mechanism of the GI mucosae that have been damaged during chemotherapy. In this regard, AP was shown to be beneficial to cancer patients ... the damage by CY and protection by AP. 2. Materials and Methods Chemicals and Reagents All chemicals and reagents were of analytical grade and were purchased from Sigma (Sigma-Aldrich, St. ... marrow and the gastrointestinal tissues from the cytotoxicity of CY in mice. We also profiled the changes of the expression of growth factors in gastric tissues in response to the damage by...
- 6
- 655
- 0
Báo cáo y học: "Update on the treatment of ocular toxoplasmosis"
... of ocular toxoplasmosis. The efficacy of the drug was reported in cerebral toxoplasmosis in AIDS patients. The dos-age used by Rothova et al was 250mg a day or 500mg every other day and therapy ... environmental factors and ocular toxoplasmosis can heals spontaneously after two to three months even in the absence of therapy. A review of ophthalmic literature shows that no standard therapy could ... shown their efficacy in vivo in the treatment of toxoplamosis. To increase the efficacy of therapy a combination of sulfadiazine and pyrimethamine was proposed since synergistic effect of these...
- 3
- 522
- 0
Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc
... ere reduced to s20, wby standard procedures. Analysis of the state of association The state of association was analysed by size- exclusionchromatography experiments at 20 °C on a Superose 12column ... ferroxidase center residues, typical of mammalianH c hains, and the carboxylate residues forming the micellenucleation site, typical of mammalian L chains. C omparison of the amino-acid sequence ... (70.5 and 70.4,respectively). Despite the paucity of available sequence data,it appears that T. bern acchii ferritin can be classified as anM homopolymer and that the H2 chain from S. gairdnerishould...
- 7
- 609
- 0
Báo cáo y học: "Hypoxia in the pathogenesis of systemic sclerosis" ppt
... well as procollagenprolyl hydroxylases (P4HA1 and P4HA2), lysyl oxidase (LOX) and lysyl hydroxylases (procollagen lysyl hydroxylase and procollagen lysyl hydroxylase 2). Similar links between hypoxia ... capillary network can be observed early in SSc. Vascularalterations include sac-like, giant and bushy capillaries,microhaemorrhages and a variable loss of capillaries thatresult in avascular areas ... because oxygen is the terminalelectron acceptor during ATP formation in mitochondria and is a central substrate in many enzymatic reactions. Whereaslack of oxygen causes metabolic cell death,...
- 9
- 439
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... sense(GTCCTGGAGAAATATTATGTGCAG) and antisense(CGCACACAGTAGTCCCCGG) primers were used. ForGAPDH we used CCCTTCATTGACCTCAACTACATGG(sense) and GGTCCACCACCCTGTTGCTGTAGCC (anti-sense) as primers. ... factor-κB (NF-κB) pathway (i.e. PSI; dashed line) and the NF-κB/activator protein (AP)-1 pathway SN50, it was established that the NF-κB and AP-1 pathway is relevant to Cyp7b activity. All experiments ... the minus DNA strand; AP-1, activator pro-tein-1; Cyp7b, cytochrome p450 enzyme 7b; NFAT, nuclear factor of activated T cells; NF-κB, nuclear factor-κB; STAT, signal transducer and activator...
- 10
- 462
- 0
Báo cáo y học: "What determines the evolution of early undifferentiated arthritis and rheumatoid arthritis? An update from the Norfolk Arthritis Register" ppt
... that affect the severity of the disease and genes that affect the handling of the drug.Then there are psychosocial factors such as adherence to and expectations of therapy outcome. Finally, there ... inflammatory polyarthritis. J Rheumatol 2004,31:442-447.33. Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M,Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.:Functional haplotypes ... inflammatory polyarthritis and rheumatoid arthritisWhen NOAR was initially established, its aim was to study the natural history of rheumatoid arthritis (RA). The net wasdeliberately cast wide at...
- 6
- 346
- 0
Báo cáo y học: "Autoantibodies against the replication protein A complex in systemic lupus erythematosus and other autoimmune diseases" pps
... designed and coordinated the study, per-formed the immunoassays and the data analysis, and alsoedited the manuscript. All authors read and approved the finalmanuscript.AcknowledgementsWe thank ... chemicals such as hydroxyurea and camptothecin [38]. RPA has a role in sensing damaged DNA, and ultraviolet or certain chemicals induces the phosphoryla-tion of RPA32 by DNA-PK, another target of ... one of these autoantibodies [30]. In PM/DM, patients with anti-aminoacyl tRNA synthetase antibodies have antibodiesagainst only one of the synthetases, and other patients haveanti-SRP, anti-PM-Scl,...
- 10
- 447
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ