Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 NM_004281.3 BCL2 -associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... -2.4 ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transport...

Ngày tải lên : 13/08/2014, 01:20

21
376
0

Báo cáo y học: "Antibodies against PM/Scl-75 and PM/Scl-100 are independent markers for different subsets of systemic sclerosis patients" doc

... or the clinical characteristics of the patients. Statistical analysis The dataset was analyzed by means of the SPSS version 15.0 statistical package (SPSS Inc., Chicago, IL, USA) and the cal- culation ... study included 113 patients with lSSc, 96 patients with dSSc, 51 patients with an overlap syndrome, 16 patients with UCTD, and 4 patients with SScSS. The clinical and e...

Ngày tải lên : 09/08/2014, 01:22

9
473
0

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... broad range of bacterial species. The polysaccharides often constitute the outermost layer of the cell, and have been implicated as an important factor in the virulence of many animal and plant ... in A. actinomycetemcomitans SUNYaB 75 (serotype a) con- tains 14 ORFs (Fig. 2A) . A protein database search was performed with the programs FASTA [37] and BLAST at the National I...

Ngày tải lên : 17/03/2014, 10:20

9
625
0

Báo cáo y học: "Reduction in antioxidant enzyme expression and sustained inflammation enhance tissue damage in the subacute phase of spinal cord contusive injury" ppt

... proinflammatory factor, TNF -a and IL-1b (T/ I) at the doses of 20 ng/ml. The total proteins were extracted, separated by SDS-PAGE, and analyzed by western blotting with anti-b-actin, anti-GFAP. Wang ... follows: anti-b-actin, anti-actin regulatory protein (CAPG) and anti-cathepsin D (CATD) antibodies (Santa Cruz Biotechnology, Santa Cruz, CA); anti-GFAP and anti-GAPDH antibodies...

Ngày tải lên : 10/08/2014, 05:21

16
429
0

Báo cáo y học: "Gene polymorphisms in APOE, NOS3, and LIPC genes may be risk factors for cardiac adverse events after primary CABG" pdf

... of the CETP variant, and hetero- or homozygosity for the prothrombin G2021 0A variant. Patients had to be homozygous for PAI- 1 5G insertion. Statistics For statistical data analysis Microsoft ® ... med- ical therapy of risk factors have become the basis for secondary CAD prevention after primary coronary artery bypass grafting (CABG). Appearance of cardiac adverse even...

Ngày tải lên : 10/08/2014, 10:20

8
404
0

Báo cáo y học: "An artificial intelligence tool to predict fluid requirement in the intensive care unit: a proof-of-concept study" docx

... treat- ments are given simultaneously to a patient in the ICU and interact with each other. The nature of these interactions is likely to vary from patient to patient, and perhaps even within the ... physiological data from the previous 24 hours. Materials and methods The Laboratory of Computational Physiology at Massachu- setts Institute of Technology developed and maintain...

Ngày tải lên : 13/08/2014, 11:23

7
291
0

báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx

... are aug- mented by the behavioral analysis. We thoroughly assessed motor movement using an automated locomotor activity test and Rotarod apparatus. For the total distance and vertical activity ... work examined microglial activation at early stages following MPTP administration; thus, it is possible that examina- tion of pathology at later stages is a better indicator of microgli...

Ngày tải lên : 19/06/2014, 22:20

16
468
0

Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

... natural conditions. Concomitent variations in leaf water potential and stomatal conductance were studied in relation with vulnerability to cavitation. 2. MATERIALS AND METHODS 2.1. Plant Material Five ... vulnerability to cavitation in Fagus sylvatica can acclimate to contrasting ambient light conditions, and we conclued that stomatal response to water stress occured early and suf...

Ngày tải lên : 08/08/2014, 14:20

10
329
0

Báo cáo y học: "Gender differences in suicidal expressions and their determinants among young people in Cambodia, a post-conflict country" doc

... study, carried out the data-collection and analysis, and drafted the manuscript. GK participated in the design of the study, performed the statistical analysis, contributed to the results section, interpretation ... study through the school administration and the parent association, respectively. We informed the students that participation was entirely voluntary and that they co...

Ngày tải lên : 11/08/2014, 15:22

8
411
0

Báo cáo y học: "SIV antigen immunization induces transient antigen-specific T cell responses and selectively activates viral replication in draining lymph nodes in retroviral suppressed rhesus macaques" pptx

... TTGCAGCACCCACAACCA-3’ Reverse: 5’-TGATCCTGACGGCTCCCTAA-3’ Probe: 5’- CTCCACAACAAGGACA-3’ IFN-g Forward: 5’- GTGTGGAGACCATCAAGGAAGAC-3’ Reverse: 5’- CGACAGTTCAGCCATCACTTGGAT-3’ Probe: 5’-ACTGACTCGAATGTCCAACGCAAAGC-3’ GAPDH ... experiments were performed in strict accor- dance with the standards of the Association for Assess- ment and Accreditation of Laboratory Animal C are Internati...

Ngày tải lên : 13/08/2014, 01:21

11
287
0