Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt
Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx
... Covello11Plant Biotechnology Institute, Saskatoon, SK, Canada;2Department of Chemistry, Carleton University, Ottawa, Ontario, CanadaThe mechanism by which the fatty acid (1,4)-desaturase of Calendula ... Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula of cinalisDarwin W. Reed1, Christopher K. Savile2, Xiao Qiu1, Peter H. Buist2and Patrick ... deuterium labelling; Calendula. The D12-oleate desaturase (FAD2) family of enzymes aremembrane-bound nonheme iron-containing proteins thatcarry out a fascinating array of related oxidative transfor-mations...
- 6
- 341
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... J.,Qiang, B. & Rao, Z. (2001) Crystallization and preliminary X-rayanalysis of a Trx domain of human thioredoxin-like protein. Acta.Crystallogr. 57, 1712–1714.32. Otwinowski, Z. & Minor, ... C-terminal regionis rich in acidic amino acids, if it does have some interactionwith the N-terminal domain, the mechanism of regulating the catalytic activity may be similar to that of the dimer. ... domain remains unknown.Overall structure Crystals of the catalytic domain of hTRXL (hTRXL-N)were obtained from ammonium sulfate by hanging-dropvapor-diffusion method [31]. The crystals diffracted...
- 9
- 533
- 0
Báo cáo Y học: Ruk is ubiquitinated but not degraded by the proteasome ppt
... immunoprecipitateswere analysed by Western Blot using anti -Ruk antibody raised against the last 17 C-terminal amino acids and thereby able to recognize all Ruk isoforms (Ruk L, EE-tagged Ruk L, EE-tagged Ruk M and ... antibody to checkexpression of Ruk isoforms (C).Ó FEBS 2002 Ruk is ubiquitinated but not degraded by the proteasome (Eur. J. Biochem. 269) 3405 We found that Ruk L binds to PtdIns-3 kinase via the ... recognized by the 26S proteasome or, in certain cases, by the lysosomes/vacuoleand rapidly degraded. Ubiquitination of target proteinsinvolves a cascade of reactions catalysed by the E1, E2...
- 7
- 317
- 0
Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc
... C-terminal protein sequencer. Proteolytic processing of proZPC in granulosa cells In order to investigate the proteolytic processing of proZPC in the granulosa cells, we raised antiserum against ... 2002 Proteolytic processing of ZPC in quail granulosa (Eur. J. Biochem. 269) 2227 Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells Tomohiro ... accumulation of proZPC in the pres-ence of brefeldin A, and conversion of proZPC to ZPC in the presence of monensin, indicate the possibility that the proteolytic processing of ZPC occurs in the Golgi...
- 9
- 300
- 0
Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has specific structural and biochemical properties potx
... expressed in antiviralIU equivalents by a comparison with a calibrated porcine IFN -a laboratory standard. The amount of IFN-c (mg) wasdetermined by ELISA. Specic antiviral activity wasexpressedinIUặmg)1.Growth ... potential glyco-sylation sites present on the IFN-c polypeptide core. Theycould differ in the rate and site of glycosylation, considering the 22 500-Da band as bi-glycosylated and the 18 000-Daband ... includes two glycosylatable Asn at positions16 and 83 (in grey). Expected trypsin cleavages are marked by slashes, and peptides analysed by MALDI-TOF are underlined. The twoarrows point to the inferred...
- 10
- 380
- 0
Báo cáo y học: "anagement of upper airway edema caused by hereditary angioedema" pptx
... pulmonary edema. The exact pathomechanism of this phenomenonis as yet unknown [8-10]. Edema of airway the upper (UAE) in HAE1. UAE Mortality Upper airway edema (UAE) may lead to asphyxia by causing ... management of hereditary angioedema. Allergy AsthmaProc 2009, 30(3):338-42.41. Farkas H, Gyeney L, Gidofalvy E, Fust G, Varga L: The efficacy of short-termdanazol prophylaxis in hereditary angioedema ... mitigate the risk of upper airway edema and also improve the patients’ quality of life.Notwithstanding the foregoing, any form of upper airway edema should be regarded as a potentially life-threaten-ing...
- 8
- 328
- 0
Báo cáo y học: "An important step towards completing the rheumatoid arthritis cycle" pptx
... intimately involved in the pathophysiology of rheumatoid arthritis and complete our model (the rheumatoid arthritis cycle) for the development and chronic nature of this disease. Rheumatoid arthritis ... synovial proteins like fibrin(ogen).EditorialAn important step towards completing the rheumatoid arthritis cycleWalther J van Venrooij and Ger JM PruijnDepartment of Biomolecular Chemistry, ... deiminase (PAD)enzymes. These enzymes are activated by the elevation ofcytosolic Ca2+-concentrations, for example when cells under-go apoptosis. Step 2When the dying inflammatory cells are not...
- 3
- 283
- 0
Báo cáo y học: " Predictors of disease progression in HIV infection: a review" ppt
... Research, Sydney, Australia, University of New South Wales, Sydney, AustraliaEmail: Simone E Langford* - simone.langford@med.monash.edu.au; Jintanat Ananworanich - jintanat .a@ searchthailand.org; David ... found in East Africaand Subtype CRF_01 AE is seen mainly in Thailand. Cau-casians are predominantly infected by subtype B, seen in 12% of the global HIV infected population [99]. Themajority of ... of transmission have a lesser role in disease progression, they may impact other markers such as viralload. Finally, readily measurable markers of disease such as total lymphocyte count, haemoglobin,body...
- 14
- 485
- 0
Báo cáo y học: "An N-terminally truncated envelope protein encoded by a human" ppt
... with mAb 6A2 B2 on human placenta (A) and an acute MS lesion (B). Arrowheads in A point tosyncytiotrophoblast cell layer. Strong staining with 6A2 B2 was seen in a case of fulminant MS in activated ... propose todesignate ERVWE2, has retained coding capacity and can produce ex vivo an N-terminally truncated Env protein, named N-Trenv. Detection of an antig en by 6A2 B2 in placenta and multiple ... located to the cell surfaceSyncytin-1 has been reported to be a moderately glyco-sylated protein with seven N-linked glycosylation sites[29]. By analogy, we studied the glycosylatio n pattern...
- 14
- 166
- 0
Báo cáo y học: " Regulation of primate lentiviral RNA dimerization by structural entrapment" ppt
... CentralPage 1 of 16(page number not for citation purposes)RetrovirologyOpen AccessResearch Regulation of primate lentiviral RNA dimerization by structural entrapmentTayyba T Baig, Christy L Strong, ... hours of culture [52], the majority of theirgenomic RNAs may have been matured by slow-acting dimerization site(s), which may explain why most of theirSL1 mutations were phenotypically silent. ... Laughrea M: Impact of human immunodeficiency virus type 1 RNA dimerization onviral infectivity and of stem-loop B on RNA dimerization andreverse transcription and dissociation of dimerization frompackaging....
- 16
- 132
- 0
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx
... c-myc tag wasinserted into the pcDNA3.1(+)/Zeo HuPAR2 backbone bysite-directed mutagenesis with the following primer pair:5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCT-GAAGAA GATCTGATGGCAGCACCCACG ... populations were assayed for PERV -A binding and infection by a FACS-based PERV -A SU IgG binding assay and a PERV pol qPCR-based infection assay. PERV pol copy numbers were normal-ized to wild-type ... relationships of HuPAR1 and HuPAR2are not only important to further a general understanding of gammaretroviral cell entry, but also, central to advanc-ing a science-based risk-assessment for a...
- 15
- 330
- 0
Báo cáo y học: " An immune reaction may be necessary for cancer development" ppt
... Het-erotransplantation of human cancers into nude mice; amodel system for human cancer chemotherapy. Cancer 1978,42:2269-2281.46. Molthoff CFM, Calame JJ, Pinedo HM, Boven E: Human ovarian cancer ... infection might be seen; thus, it may like-wise be facilitated to grow, rather than be inhibited, bywhatever weak immune reaction may be produced.Indeed, it has been shown that a very tiny tumor inocu-lum ... this hypothe-sis cannot, I believe, be excluded by any presently availa-ble data.Even if a facilitation phenomenon might initially be nec-essary for the growth of in situ tumors, the immune...
- 9
- 271
- 0
Báo cáo y học: " Binary gene induction and protein expression in individual cells" pptx
... observe binary, hybrid and graded protein expression. Protein expression histograms of β-gal, Luc and GFP In examining different mode of gene induction, severalreporter genes have been used. To investigate ... of gene expression histograms for binary and graded modes of gene inductionFigure 1Schematic representation of gene expression histograms for binary and graded modes of gene induction. Gene Expression ... replaced with binary ones if β-gal is used as thereporter protein. In addition to the binary and graded pro-tein expression patterns, the gene induction model alsocaptured an array of intermediate...
- 15
- 268
- 0
Báo cáo y học: " ISS mapped from ICD-9-CM by a novel freeware versus traditional coding: a comparative study" ppsx
... by a novel freeware versus traditional coding: a comparative study.Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 201018:17.Di Bartolomeo et al. Scandinavian Journal of ... exploit this advantage, a proprietary program that maps ICD-9-CM into AIS codes hasbeen used for many years. Recently, a program called ICDPIC trauma and developed in the USA has becomeavailable free ... based on direct AIS coding by expert registrars.Materials and methodsWe used the database of the Italian Trauma Registry(RITG) and the standard administrative database of hos-pital dischar...
- 7
- 209
- 0
Báo cáo y học: "Creation and disruption of protein features by alternative splicing a novel mechanism to modulate function" docx
... ++++g + + G++ SK eAkq+AA +AL ++FSVSAELDGVV CPAGTANSKTEAKQQAALSALCYIAeaALrkL A+ +A+ + LAARAWENLpksaLqelaqkrklplpeYelvkeeGptPahaprFtvevkvggktyvrktfgeGsGsSKKeAkqaAAeaALrkL++s+L e +a l + l +e++p P+ ... of AG-GT splice sites. All splice forms wereGeneral mechanisms to alter linear protein features by alternative splicingFigure 3General mechanisms to alter linear protein features by alternative ... disruption of protein features by alternative splicing - a novel mechanism to modulate functionMichael Hiller*, Klaus Huse†, Matthias Platzer† and Rolf Backofen*Addresses: *Institute of Computer...
- 8
- 252
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015